Description :
From Genome Similarity Track
Location :
Scaffold_988:2954- 6213
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_988-snap-gene-0.3Zinc finger family protein

Sequence
3259 bases(100 bases per row)
GCGCCGCCAACCTCTCTGCCACCGCCGATCAGCAACAACCAGGTTTGCGGATACACAGGATGCCTAAATGAGTCATTTCCATCTCCGCTAACGTTGCCAA
TTGTTTGGCTTTGTAGGACCAACAAACCCTCCTGAAGGCGCAGATCCGGCAGATCCAGGCAAGCTCATCGCTCACGCCCAAGGAAAAGGCCGAGTCGGTG
CAGAACCTCATGATGAAGCAGTGGAACGACTCGCGCGACAAAGTGGTGCTCAAGCGCCAGGAGAGCGACAGCGAGACCGACCGCAAGAAAACCACCTACT
TCGTGAGTGCTTGCCTCCATTTCCTTCTCTTGATTGCACTCAACTCAGTGTTAATCTTGGATGTGTGAATTTGGTACCTATAGAGCGAAGCGGAGAATGT
GCTTGGGTGCAGTCACTACCAGTACGTGGATGCCTATTGATCTGGCTTGGATGTAATCTGTCGACTGTAGCAGATTTTCTAACTATATACTGCTACACTT
TCTGTTCCTCTACTATCTCATCAGGCGCTCATGCAAGCTACAGGCGAAATGCTGCAGCAAATGGTACACCTGTCGGTTTTGCCACGGTGAGTTTCTCTAC
AAATTGTTGTGTGCTTTGGCCTATGGAACTATGGACGTGCGCAATGATTTCCTGACAATGTTCCTCAATTCGCTTCGATTCTCTGCAGATGAGAACGAAA
GCCACGCGATCGATCGCTACGCCACCGAGACCATCTCGTGCATGAAGTGCGAAACTGTCCAGGTACAAACAGCCCTCAGAAACCGTCGCTACCCAGGGTC
TATCGTGAAATGGTTCTAACCCAGTTCTACCCCATTGATGTGTGTCTTTCATTCTGTACCAAGGCCGTGTCCAAGCAGTGCATCAATGAGAAGTGCAACA
CGGTCTTCGGGCGGTATTTTTGCGATACCTGCAAATTCTTTGACGACGACCCGACCAAAGACATCTACCATTGCGACAAGTGCAAGATCTGCCGCATCGG
CAAGGTGCGTGTGTGCGACTTCTCCACTTCGAAATTGGTTCACGTGAGACTTTAGCATTGCTTGACTCACAGTCTTGCTCCACTCTCGTGCTCTCAGGGT
TTGGACATTGACTACTTCCACTGTGACCGGTGCAACGCGTGCATGAGCATCAGTCTGAAAAAGCACAAGTGCGTCGAGCGGTCGCTCGAGTCAGACTGCC
CAATCTGCCACTCGTACATGTTCACGTCCACGACACCAGTCATGTTCCTGCCCTGCGGTCACTGCATGCACGTGTCGTGCTACGAGGAGTACACGCTGAC
GAACTACATCTGTCCGCTCTGCTCCAAGTCACTCGGCGACATGGAGCTCTACTTTGCGAGCATCGACGAGCTCCTCGAGCGCGAGCAGATGCCGGCCGAG
TACCAGGACGTCAAGTCGCTCATCTACTGCAGCGACTGCGAGCGCAAGTCCACGACCAACTTCCACTTTGTCTACCACAAGGTACGGTGCAGCCACAGTC
TCTACCAGCGTTGTGGTTTGATATCTAACGAGCTCTCTCTTGATGCATTTCTTGATGTATTGTTCCTGCAGTGCCAGTACGACGACTGCATGTCGTACAA
CACCAAGCTGCTGCGGCAGTTCAAGGAGACAGACTCACACATCGCGAGCGCCGAGTCCGAGATTCTCGTGAACCTCACGCAGTAGACCTAATTTATCACA
ACATGATGGATGCACACACAAACACGCACCGACACCGACTCATCCGCGGCAAAGCACAGACGAACGATAGAACCAAATAGACGCAAAAACGCTGTAGCTC
TTCAATCAGCCGCATATTTATTAATCCCAACTAAACTACGATCAATACATACACAGACACACACGCACGCATGCATACACACAGATGGATATATTCGGAT
GGATATGTGCGACCCAGTTCTTGAGAAATGTCAAAGGGAAGACAGTTGTCACTCTCTACACACAAAAGTCGCTGGCAAAGGCTGTTCTAGCGCTAATGGG
GGCGAGTGCGCGACCCGGCACGGGGGACTGCGCTTGACACTTCTCAGCGCCGCGCGCAGCCGCAAAGCCAGGCCTGCACATCCAATTAGACCCACGCGCA
ACACGCATACAGTGGATACACATGCATACGCATTGTTGATCGGGACAGACACACAAGCTGCTCGCTGACGGGTGGCTTACTTGGACAGGAAGAGATGGCA
GGAATGGCACAGATGATGGGAGCTGTTGGGCGGGAGATTGATGAATGAGTGAGTGGCCATCTGGCACCAGTCACTTGCGTGAAACCGACCGATTCCAGTA
AACCTTGATTTTCGTATGCTTAACGACCAGCCGACCAACTACTGTTTTTAAGCCAATGAGATAAGGTAATAGTAATTAAATATTATTGGCCAATTAAAAT
CATTTCTCGACTAAGTGCATTTGTCAATTTTGATTTTGAATTTATCCGGTGACCGGATTATAAGGTATTGTAGGTTGTTTGCGCTTGTAGCACCAATCCA
CAAACTCGCCGCTCTTAGCGCACTGCAGCTCCTCGATGTGCACGCGCAGCGGGTAGTCGAAGTTCGCCAGCGTCACAAACCTGATGTGTGCGTGCTCTAG
TGGGATCATAATGAGCAACATGTGCGCGCAGAACACGACGTCAGCCGCTGAGAACGCGTCACCGGCGATGAACCTCGTGCCGATGAGGGCGTTGCCGAGT
TTCTTGTCGGTTTCTTGAGCCATCCTCCCGACACACTCGACCGACTTGGCGGCACCTCCCTCAGTGACGTGCAATCTGCTCAGTAAGATGTACCGAAGTA
GCGGGAAGAGGAGATGTCCAGCCTTCGATGGACCCGATGAGCACTTGCTTCGCCTGTGACTTCTTTGAGGAGATAATGAAATAGGTTGTGTACGTACCCA
AAGAAGAGCAGAATCAGTGAGCTGGCTGGTACTGGACTACTAGCATGCGATATATTCGAAGACAAACACGTACCGCATCTTCTAGCGCGCACCCCTAGCT
CCTTGTCGTAGTAGAGCTCCAACGCTTTCGACCCTTCGGTTGGATATAAAGACGGGAGCTCTTGAACGCAAAAACCCAAGATGTCGGAGCTGTCCGTGAG
CGTTTTTTTCGATGCAGGGAAGTAGAGCAACGGGACCATGTCGTCGCCTTTCAGCCGCGTGTTGAACGCGTGGACAACCGAGAGGAACTCGTCCTCAACA
AAGGGCATGTTCGCGAACTGCAACGCCCAGCGTCCCTTCACGTAGTTGGACGCCGAGAT