Description :
From Genome Similarity Track
Location :
Scaffold_402:2954- 4200
Sequence
1246 bases(100 bases per row)
TAGGCTGCTGGGGCGTCGGAGGGCAAGAACTTACTGCTGAAAACGCACCTTCGATGCTGTTTCGTCGTTTCTTCATTGCCATGGTACTGCTGGGGCCGGT
GGTGGTCATGCTGACAGCAGGCGTGTCGGAAGACAGTGCTGGGAGGTAGGACGAAAGCTGAGGGAGTGCAGTTCGAGACGGCTCCATAGTGCCAACTTCT
TCCTAACCGAGATGGACACCACGCTTTTCGTGGGGTGAATGCGTGGATGGGTTCGAAAACGAGAGTGAGTGAAGCGCGTTGGACCTCTCTCCTGTCGGTT
TGTGCGGCGGTTCTTCTCTGCTCGATACGGGAATACGCGTCACGCATCGAGTTGACCGGCAGGGTTGAGAAGGGCCTTTGGTATGTGTGGCCAAAGCGTC
CCTAGATTAACGGCATCATTCGTGCGTGAGTTTACCGGTACTGTCGTCGCGGGCTCCGTTTTCTCCCGGGGCCCTTCTGCAGCTCTGCAGTATGTAAACA
TTGATGCGTGCGCAGCTACGCATCGTGATCGGAGAATCCGGTTCACCACCACAGATGGTTGCAGTTGCTAGTCGAAGGCGTCCGTCACTTAAAATCTTCC
GCCACTGCCTTGTCGCCGCCGTCAAGCCCAGGAATTAACGGTGCTTCCTAGCGAAATGGTGCTGCAATGCATTTCTTTTGGCTGGGGCGAAGGCCGGCAT
AAAGGACTTTCAAAGCCGAACTTGGCTCTCGCGATGCAGCCGTGCAAGACAAAGAAGCTGCTGCGCATTGAAGTTAACACGTTGATTGTGCTGCCACTGC
AAGTTTGCTCGGCATCCCACTTTCGATTTAGCCGAGCAGAGAGCAGAGCCCCGACAGCCCCGTACGAGCTGAAGGGATCGAGAGTGGAACCAGTACAAAC
GACCAGTCTATCTCACACTGAGCATAGCAACTCTACTCAGATCGACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN