Description :
From Genome Similarity Track
Location :
Scaffold_13:2954- 3970
Sequence
1016 bases(100 bases per row)
TCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGATCCCGTACATCCCCCATCAGATACTTCTTTAGTC
CTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCAAAAATTTGGGGGTTGGATCCAATCCT
TCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCTGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGC
TCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACT
CGTGATTCATCCAGCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTTGCCTCGCACCTGTCTGATCAC
CAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTG
AGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGG
ATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATATGGATCCGGTGTTTGGGCTCTTTCTTAGGAGCGATCCTGGT
CAGTGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTTCCCTTTCGAACATTTCACAATCTCCAGTGTCCAA
GGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTAAATAGCCAAGCTAGCGTAGAGTGTCGAGTCTGGGTCCGGATGGATC
TTCCCACCAGCAGGTT