Description :
From Genome Similarity Track
Location :
Scaffold_70:29539- 33412
Transcript NameFunction/comments
Sapdi_VS20SDRG_14305hypothetical protein
Sapdi_VS20SDRG_14306hypothetical protein

Sequence
3873 bases(100 bases per row)
GCGTCGAGCGGCGCGAAGCTCCACGTCCTCGCCGACCTGCCCAAGCTCGATCGCTGCGACAGCGACTGCGTCATCTGCATGGGCGCCATGGACGACGGCG
CGATCGAGCTGCCGTGCGGCCACCACTTCCACACCAACTGCATCGACGCGTGGCTGCGCCTCCGCAACACGTGCCCCACGTGCCGGTACCAGTTTGAAAA
GCAAGTCTCTGGCACGTATGCGATCCGCAGCATCAACACGGCGCTCTGCCTCGACGGCGTGCGGTCCGCCGACGTCGACGACGTCCTCGGCCGGTCGCTC
GACGGCTCGGCGCTCAGTGCCATTGTGCACGTGACCATGGTCCCGGCGGCGACGCTGCCGCCCATGGAGCGCTACCCGTGCGTCATGAACGCAGCCATTG
TCCGCGGCCCCGCGCCGACAACCAACGCCGTGCGGTCACCGTCGGCGAAGCGCAGTCGCCCCCACGAAGCGACGCCGCCCGTGCCCAAGCACACTAAGTT
ATGTTAAAGTTATTCGATAGACGTTTGTAATATAGTAGAAATGATGATGCTTGTTGTCTTCGACCGTCCGCGCTCATTTTGGTCCGCGCTCGCTGGTTCT
GGAGACAGGAGCTGATCGCAGCTTGCAGAGTAGCGAGCGACCGCCGTCTCTACAAGCCTTGCACGCGACACGAAGGCGTCTCTGCGATCGCCAGCAAGAC
CACATCCGCGTGCTGCGCAGCGGTCGCTGCGACAGCATCGCTTGCGTCCGCCCGTGCCAGCTCCGCGACAGAAACGGGCTCCGACCTCACGCGTCTCTTG
TCCAGCCACGCCCGTCCTTATACTGAACCCTTGGTCGTCGTTCGGGTGCGGCGTCATGTCCTCTTCGCCTTGGAGGCGGCAAGACTAAAGGCAACTAAGA
TCCGACTAAGCTCTTCCTCTGCGCCACCTCCTTGCTACATCGTACGCCGTGTAAACCAGTAGCTTGACGACCACGAGTGCTGCCGCTCCCATTCTTCTTC
TTCACTGCATCGTCCCAGCGGCGCCTGTCTGCGAAACACTGTTTTCGCCACTGTTTCGATCGTGATACAGTGTGTCGGTACCTGTGGTTAAACGTGGCAG
ATGCCAAAAATACACGATTTCCGTGCGCACACTAATTGCGGCGCTGCTGGAGCCAACCAGCGGCGATTGGTCGTGACGATTAGACGCTTCAACACGGAAT
TTCGCAAGATGGCTCCTCGGCGCAGCAAGAAGGGCAAGGCCAAGAAGACCGACGTGTACGAGCACGACGACGACGAGGCCAATGAGGCCCGCGAGGCCGC
GCGCATGGAGATCGACGGCGTCTACGAGTACGAGGCGCCGGCCAAGATCGCCCGCGACGACGACTCGGAGATCGATGAGGACGGCGCGTTCGACTCGGAG
GACGACGCGACCTTTGGCTCGTTCTTTAGCGGCGGCAAGACGACGACGTCTAGCAAGAAGAAGGCCGCGGGAAAGAAGGCCTCGGGCAAGAAGGCGGCCG
ACAGCGACGACGAGGCCACGGCCAGCAACGACGAAGACGACGACGACGAGGCCGGCGGCGACTTGCTCTCGGACATGCTAGGCACGGCGCCGGCGGCGCG
CCTGCCCACGGCGGACGACGAGGATGAGGACGAGGATGACGAGGATGACGACGATGATGAGACCAAGCACGCGTCGCTCATGTCGATGGTCGATGCGATG
GCCAAGGGCCCGAAGCGCAAGATCGCGCACGCCGAGATGACGGAAGACGTGGCGCCGTCTGCGTTCAGCAAGAAGATTGGCGGCGCCGAGCTCACACTGG
CGTCGCTCATGGCGTCGTCGATGCCGTCGCTGCCCGGCGACGAGGACGACGAGGACGACGATACCAAGGACGAGGTCATGGCGTCGGGCTCGGCGGCGGC
GCTCAAGCGGCAGTTTGCGCAGCTCGAGGCCGACGACAGCAAGCTCTCTGCGCCGCTAGCGCCGGTTCTTGATGCCCGCGCGTCGCGCAAGGTCGCGTAC
GACGCCAAGAAGAAGGACCTCGACGTGTTCGTGCCGGTCGTCCAGCGCAACCGCCAGAAGGAGACGCTCGACTTTCGTATGCAGGGCAGCGCGCCCGCGC
CCAACATCACGGTGGCCAGTCTCACGACCAAGTTCAAGCCCGAGAAGCCGCTCGAGAACGACGTGGCGGCGCTCTTGGCGACGTCCGGGTGGTCGGACAA
GGCGGCGGCGGCCGACGAAGCCGCTGCGCTCGAGATGAACGCGCTCTCGACGGAGGAGGTCCAGGCGCGCCAGAAGGAGCTCGCCAAGATGCGCGTGCTC
ATGTTTTACGAAGAGCAGAAAGCGCGTCGCGTCAAGAAGATCAAGTCGAAGCTATACCACAAGATCCGCAACAAGCAGGACGCCAAGCGCGAGCGGTCGC
AGCTCCGGGAACTCGACCCGGAGCTCGCCGACCAGCTCGACCTCGAGGACGCCGAGAAGCGCGCAGAAGAACGCATGACGCTCAAGCACAACAACACGTC
CAAGTGGGTCAAGCACCAGCTCGGGCGAGGGATTCAGGCCGACGCCGGTACGCGCCAGGCGATCCACGACCAGCTCCGGCGCGGTGATGAGCTGCGTCGC
AAGATGGACACTGTCGCCAACGAGAGCGACCTGTCCTCGGACGACGACAGCGAGACGGAGACCAACGAGACGGAGACGCAGCGCCTCCAGCGCAAGCTCG
CGAAGAAGGCGTCGGCGCTCGTGATGGAAATCACGGCCGACGCCGGGGCGTCCAAGGCCGACGGGCTCCACGGGATGAAGTTTATGCAAAAGGCGGTCGA
GAAGCAGCGCGAACGCGCGCTCAACGACGCCGAGAAGCTGCTCCAAGAGCTCCGCGGCGACGACTACGACGACAACAACACCGACGACGACGACAACCCG
GCGCCGGCCAAGAAGGCCAAGAAGACGACCAAGGTGACGGCTACCGACAAGAAGGCTGTGGCCGCCAAGATGGTCCACGGCTCGCAGCAAATGACGTCCG
TCATGATGGACAAGGCGCACAAGACGCGCGTCTCGTCGGCCATTCAGATTGACTTTGGCGACAGCGCGCCGGCACCGGTCGTGCTCGTCGACGAGTCGGC
GCCCGAAGCGTTTGCATCGGTGGCAACTGCCGCGCCCGAGAACCCGTGGCTCGACGCGACGGCCACCAAGAAGCGCAAGAAGCCGCGCAACCGCAAGAAG
GCGGTGGCCGAGTCGGCGACGATCGGGTCGGCGATCGCCTCGCTCGCAACGACGTCGGACGCGCCGGCGACCGGCATCCTCGGTCCGTCGGCGGCCGATA
TGAAGAAGCGCAAGGCCGCCGACACGACGACGCCCGCGACCAAGAAGGCCAAGACGACCGATGCCAACGCTTCGGCCAACACTTCGGCCACCGCCAAGAC
CGAGACCAAGACGGAGGCCAAGACGGAGGCCAAGCCGACGACGCAGAAGAAGCCGACGACGTCGTCGGCCGACCTGGCGCAGGAGGAGCTCGTGCGCCGG
GCGTTTGCGTTTGCAGACGAGGGCGACGACGAGATCGGTGCCGAGAAGGACCGCATCGCGGCCGAGGACGGCGACGCCAAGTCGGGTGCGGAAGTGGCCA
AGCTCACGGGCATGACGGGCTGGGGCTCGTGGGCCGGCGAGGGCGTCAAGACCTCCAAGCGGCAACTGGCGCGCCTCGAGCAGGCCAAGGCCGTCGCCGC
GGCTGCCAAGCTCGCGGCGCTCAGCAAGCGCAAGGACGCCAAGCTCTCGCGCGTCCTCATCAACGAGAAGAAGGACAAGAAGGCGGCCAAGTTTATGGTG
GCGAGCGTCCCGTACCCGTTCACGTCTCGCGAGCAGTACGAGCTCGCGATGCGCAACCCGCTGGGCGCCGACT