Description :
From Genome Similarity Track
Location :
Scaffold_30:295369- 297621
Transcript NameFunction/comments
Sapdi_VS20SDRG_09455hypothetical protein

Sequence
2252 bases(100 bases per row)
TCTGCAACACCTTTGAGAAGCTCGGCGTCGAGGACATGTGCACGCTCAACCACCTGCACGAGCCGGCGGTCCTGAAGAACCTGCAATTGCGCCACGCGCA
GAGCATCCCGTACACATACACGGGCCAGATCTGCATTGCTGTCAACCCGTACAAGTGGCTAGACCTCTACGGCGAGGTACGCAGCATGCGAAGAGTGGCA
CTAGACCAGACTCATCCCCGTACTGTAGGACCTCTACCAAAAGTACTTGAACCAGCCGCGGGCCGAGCTTGCGCCGCACCCGTTTGCGCTCTCCGCCACC
TCGTACCTCGACATGCGCAAGCACCGCATCGAGCAGAGCATCCTCGTGAGCGGTGAGTCGGGTGCTGGCAAGACCGAGACGGTCAAGATCATGATGCACC
ACTTGGCGTCCGTCTCTGGCGGCGGCGAGAAGGGCTCGACCGTCATCGACCAAGTGCTCAAGTCCAACCCGCTCCTCGAAGCCTTTGGTAACGCCAAGAC
GAAGCGCAACGACAACAGTTCGCGCTTTGGCAAGTTTGCGCAGCTGCAGTTTGATACGAGCGGGTACCTCATTGGCGCGCGCTGCGAGACGTACTTGCTC
GAGAAGAGCCGCGTCGTGGGCCAGACCGAGGGCGAGCGCAACTACCACATCTTCTACCAAGTGTTTTCGCTGGCCTCGGAGCTCAAGAAGACGCTCTTCC
TCGAGGGCAACGTCGCCGACTACAAATTTGTCAAGGTCGGTGCGGGCTCGCGCGTCGACAACACGGACGACTCGGTGTTTCTCCAAGAGACGAAGGATGC
CATGGACACGATCGGGATCGACGACCGCGAGCAGCACGGTATCTTTGAGATCGTCTCGGCCATCTTGAACCTCGGCGAGGTCGCGTTCACGGCGGTCAAC
GCCGAGAGCAGCCAAGTCTCAACGTCCGAGAACCTCGCCGCCGTCGCGGCGCTTCTCAAGACGGCGCCGGAAGCGCTCACCAAGACGCTCTGCCAGCGCA
CCATGACGACGCGTGGCGAGACGTTCACGATCCCGCTCAAGGTCGACCAGGCCTTTGACCTCCGCGACGCGTTCGCCAAGGGTATTTATTCGCGCCTCTT
CGACTGGCTCGTCGGGCGCATCAACCGGGCCATTTGCTCGACCAAGAACGTCTCGTCGCACATTGGTCTCCTCGACATCTTTGGCTTCGAGTCGTTTGAC
CACAACGGCTTTGAGCAGCTCTGCATCAACTACGCCAACGAGAAGCTCCAGCAAAAGTTCAACAGCGACATCTTCAAGACCGTCCAGGCCGAGTACATTG
AAGAGGGCATCCCGTTGGACTTGGTGACCTTCGAGGACAACCAGCCGATCCTCGACCTCATCGAAGGCAAGCTCGGCATCGTCGACATGCTCAACGAGAC
GGGTCTCCAGCCCAAGGGCGACGACCGCATGTTTGTCAACAAGGTCAACGAGTCGTTCGCGGACCACAAGAACTATGAGAAGATCCGCACCAACCCGATG
CAGTTCAAAATCCTCCACTACGCCGGCGACGTGACGTACGACGGCACCAAGTTCCTCGACAAGAACAAGGACACGCTGCCCGCGGACCTCATGGAGCTCC
TCGCGTCGAGCCAGTCGTCGTTCATCCGCGACGTCTTCCCTGAGCTCGCCAAGGGCGGCGTCTCCAAGGACAAGAATGCCAAGCCGCCGTCGCGCCGCCA
GGGCTTCCTCGTCGGCAACACGATCGCGGGCTCGTTCCGCAAGCAGCTCGGCGAGCTCATGGACCAGATCGCCAAGACGTCGACGCAGTACGTCCGCTGC
ATCAAGCCCAACGCCAACAAGAGCGCGACCAAGTTTGACCGGCACATGGTCGTCGATCAGCTCCGGTGCGCCGGCGTCATTGCCGCGATTCGCATCAGTC
GCGCGGCGTTCCCGAACCGCCTCTCGCTCAAGGAGTTTACGTCTCGCTTTGCCATCATTTGCCCGTCCAAGCTCCGGTCGGCGCCGCCCGAGGCCATGGT
CCACGGCCTCCTCGAGATCCTCGGCATCTCCGAGTCCTCGTCTCGCAACGCGCGCTTTGCGATCGGCCGCACCAAGGTCTACTTCTCGTCCGGTCTCTTG
CAACAGCTCGAGGACCGGCGGAACGAGCTTCTTCGCAGCTTTGCACTCTGCCTCCAGCGCAACCTGCGCATGTACGCAGCCCGCGCCCGCTACCGCCGAG
TCCGCGCCGCCGTCATCGTGCTCCAAGCCCACCTCACGGCGTATGTCGCTGG