Description :
From Genome Similarity Track
Location :
Scaffold_526:2953- 4113
Sequence
1160 bases(100 bases per row)
TGGTTGTGTTGTACCATTGACTTATCAAGTTGTTAAGCTCTCCACTTAAAACTCTCTGATATCATGGGTATCTCCACAACCTCGGCACAAGAACAAACAG
CGGTCCGATGGGGGACATTTCTTTCCTTAACGGCCAGAGGTCATTCGCTTCTAACATCCCGAGTCTCTATGCTTTTTGGACGCACAGTGGGCACATTTCG
TGTAAAGAGTGGCCGACGAAGTGCGATGTCCCGAGTCTTCTGCATGGTGTCGATGCTGGTCGACCTCCCTGGTAGGTCGGTGCCTCTCGAACGCGCACCT
GGGTCCTTAACCGCTTCCGCTTCTATCATATAAACTAGAATATGGTTCCTTTAGTTGTACGAGGTTTTCATGCTGGATTCTTCTGAGATTGATTCTTCTG
AGATTGATTCTTCTAGTTTCGCTCGAACATCATGCTTGGAGCGGCGGTTGATCTCTATTGGTCGGTCAGGTGCATAAAAGCCTCCTGACAAAACTTGCTT
GATCCAAATAGCATCTTGTTTCGTCGTGCCATCGTCGTTCAAGAGCTTTCGGCACGTCCTCCCGTTTTTGCACTTCCGCCAGACGTAGCATGGTCGACTG
GTCCGCTTGATCTAGGTCGTCCAAAGTCTCGATATAGTGTTCGACAAGTTCTTATTGAATCTTAGGCGGTCTATCATTAATTTATCAACTTTGCCCTGAG
TCCAATCACATTCAGACGAATAAAGTCTATCTGGGATTCATCCGACCTCTTCTCGAAATGGTAATACTGGCGGGGGACTGGTACTCCCCAACCGCAAAAC
TGCATCTGGAATTTTGTAGTAGGTCCTTCTAATTCCCTCGAACGGAGCAACCTAGTAAAGGGTACCAGTATGCGCTGGTCCGGTCACCAGTCCTCCAAAG
GGCAAGCCATTTTTCTCCGCCTGGTGCTTGGTCTTCATAAATGCAGTCTTTATGGTAGTCGCCCTGCTGCGTACTCGTTCGTCGTTTTGATACCTCCTAT
CTAGCTCCTTGAGATCTGAGATCAACGAGAGCTTGATGCGTGGAACCACGTTTAGTGCCTGCCCCAGTGTGGCATTAGCCATTCTTGCCGGTGCTTCCTC
AAGATCCAGTTCATCCGGGTCGTACCCGCATGAGCCGACCGACTCCATTTCGACATCGTG