Description :
From Genome Similarity Track
Location :
contig_47:295277- 303231
Transcript NameFunction/comments
g7879.t1hypothetical protein
g7880.t1conserved hypothetical protein

Sequence
7954 bases(100 bases per row)
TTCCTATCACGCAACTAGCTCGTCGCTGCTCTGCTGCAGGTAGCACTTCAACTACCCACTGAGTAGTTGAGCAGCGACGGATCGATCTTCTGGCCCTTGG
TGCGGCGCTTGCCCCGCTTGTTGGAGGAACCAGTCTCAGACGCGCGCTGCTGGGCGTCCTGGTGCCCTGGCGACTTCTTGCCGCTGTGCTGCGTTTTCTT
GCGCTGGATAAACTCAGTCGCAAACGCCGACACGCGCGGTGTTGAGCCCAAATATGCCGCGAGATACTCGCGGATCTCGCCGGGATCCTCGACTGACGCA
CAGTATTCCAACAGCGTCACGTTCGCGTTACTATCAATGGTCGTCAGCTGCTTCATGGCCCACATCATAAACTCGGACGACACATTGTTTGAACCAAACG
CATTTGACGTGCCCACTTGCACGCTACCAGACGCTCCTGCCGACTCCTTATCAGCCGGCTGAGCAACCCCGAAGTTCCAGAACGATGCATCGCTTTCAGC
CTTCGGCGGCGATGGTCTAGCAGCACCGTTCACAGCACGAACCTGCTGGCGGCTCTTCAGCACAGACGCAGGCACAGGGCCTAATACTGACCGCGACGGC
TTGGGGATTGCTGCTGCAGCAACCTTGTTACCCGCCACAATGTTCATCCAGTGCGAGCTGGTCGGCACATTCTCGTTAGCCTTAGCCCGTTCCTGCGCCA
GACGTTCTTCTTCTGCCAGAATGTCACGCATCGACTTTGAGTTGGAGCGTTTAGGCACAACGGCAGGGGCACCCCACGGACTTGCTGCAGGTGCAGCAGG
CGCCGGAGTTGGGGCTGACGGTGATTTAGCTGCTGGGGCCGGGGCCGAAGGACTGCTTGGTGCCACAGCCATCGAGTCCACGCCCAGCATCATCTTCAAT
TGTGCTCCCATCTGCGCAAGATTCGAGGAGCCGGACTGCTCGTCGTCCATCTTGCTGAGCATTTCGCGCTGCTCTTCCTGCTGGATATCCTTCAGCGACT
TCGATGCATTAGAGGCAGTAGTGGATGCCATCTTGGTGGCCCACGCATTTGTCTCACTCTTAGCGTTTTCTCCTTTCTTTCCGTTCTTTTTAGGCGGCTA
GTGGTTGCCATCTTCTCGCCTTCCCTGTCAGTCTCGTCATCCTTTGCACTTGTCTTCACAGGTGATGCAGCCTTGCGCTGTTCTTGCTGTGTGCCAGCTT
GCTCACCATTTCCGCCAAGCGACTCGCGAACTTCATTAACAGCACGGCGCTTTTCATCATTCTGAATGTCATGAAGCGTTGGCGTTGGGTGCTCAGGAGA
AGTCGGGCGACCACCCCAAGCATCGACCACAGGGACCGCAGCTGGACTTTTTGGCGCGGGAGGTTGAGTGGGTTCTAGTGCCATCGGACTGGCTGGTCGC
GCACCCAGCGCGCTGGTGGCGTTGTCCAAGCTAGACAATTCCGGTGCGGCATTTGGCCAAAACGCCTGGTCGCGCCTCTGCACTTCGTTATTCAAGAACA
TCGCATCTTGACCGAGAGGCTGCGGGTTCTGCATGTTAAGCTGATGCTGTGTACGATAGTCGGATTGAAACTGAATCTGCATACCGTCTGACCGGAAGCT
GTCGTTTGCCGAGTTATTGTTGCTCTGGTTTCCTCCAAATATGCCAAGCGCACTCATAATGCCTTCACGCTGGCTGCGTTGCCACGAACTTTGCTGCTGC
AGAAGCATTTGCTGTTGTTGTTGCTGCTGCTGCTGCTGCTGCAGTTGCTGCTCTTGTTGATGTTGAAGCATCTGTTGCTGCTGATACAACTGGTTTTGCT
GTTGTTGACGTGCTATCTCAAGGCGCTGCATTTCCATGCGGATCTTCTCTTCTTGGAGCATTCGCTGCTGTTGCTGCTGCTGTAACTGCATCATCTGCTC
CTGTTGCTGTTGTTGTTGTTGACGCTGCAGCTCCAACAGACGTTGCTGCTCATTCTGGCGAAGGTCAACGTGCATACCTCCAACTCCGCCCACACGCGTT
GGCGGGGAAGCGAAAGGCACCTCTCCGTGGACAAACTGATTCGCGAGGGCCCCAAAAGTGCCTTCTCGCCCGAAACGGATTGGAAGGTGCGGCTTGAAGT
AACCCGCCTCGAACCACTCGCGCATGTCCGCTGTTTTGAACGGTCCCTGCTGCAATCCCTGAGGATCCAAGTAAAACCACTCGTCTTCCACTTCCAGACG
CAACGACGAAAGGCCCGGGAATCCCTCCTGGGGCTGCAGTGGTGAAAGCGAAAAACTACTCTTCTCCTCTAACGCGAGCTGCTCGCGAGCAGGTTCCAGC
GCATCGAACAAGTGTCCACCACTTGACTGGCGACCCAACAAATCTGCCGTGTGATCTTCCACTGGACCATTGGCACCGTTCGCGCTGTGTTGCTCCTCGG
GAGCAGAGTCCTCCCACTGCACGTCTTCATTATCACTGTCATCAAATTGCCCAGCAGCCGCAGCGTCCTCCAGTTTCTGGTCAAAAGCATCCAAATCATC
TTTGATCTCGTCCTGCCAAGCAGTACACCGTCAGTTCTTCGCTCATACGCACCTAATTCGTCGGGGCTTGGGCTTACCGGGTCGACCTTCGGTCCCTGGA
GCTCCTCTCGCATCGCATTCATCTCTCGTCGGAACTTCTCTGCGGCTTCAGCCATACTAGACAGGTCCTGTACCACAAAACACAACAAACAGCAGAGTAA
GCCATCCCCAGCTCCTTCAATATCACAATACAGGGACGCACCATTTCATTGTTATCCGTTCCAGGCTCCAGCACGTCGTCCCACACATCGTCTCCAGCGC
GAGAACTCTCAGTGACCCTAGCGGCCGCGCTCCCACGTTGAGTCTCGCTCATTGTGTCGGTGGTCGTCCCTCTGCTGCTTGGGGGCCTCGTTCTCCTCTC
CACGAGCTCCGCGTTCCTGGTGTCCGCGCGCGTTCTGGGCTCCTCCAGCGGACGCGTTACCGCGTCCACGTCCCCGACCGCGGTTACGATTAAGCGACCA
CTGCTTGTAGATCTCCTCGTAGTCGAAGGGCAACGTGCTCACGGGCGGCAGACTGTGCTCGGACGCCACCGACGTGTCCGGTGGGAACGCGGGCGCCTCC
GACGTTGTGAAATGCAGCGCCAGCAGCTCCTCCTTGGAGTAGCGCAGCACTTTGTTCTTGCGTCGGTGCTCGTCTGCTGCTCCTGCGGCTGCGTCTTTAA
AGGACGCGGGTCCGCCTGACGCCGAGGACGATACGAAACCCTCGCCGTCCTTGGACCACTGCGGACGGTAGGCGGATCCCTCGGACTCGGTGCGGCCGCG
GCCCTTCATGGCGAACATTGTGCGCGGTCGCAGCGAAATGTTGCTGCTGCTGTTGCTGGCTCCGTCTGCGCTGGTGCCCGTGGGGGCTTCTTAGCCGCGT
CCTGCTGCTGTTTCTTGCGGTGCTTGGTGGTCTTGGTGACGAAGTCGTCGTCATGGCTGGGGCTGCTGCTGCTCATGGCTGCGGCCGGTGCGCGCTTGGC
TCTCGGTTGTTGGTCGCTCCTCTTTCTTTTTGTGTGGGGGGAGCTGCGCGAGGCGGTGCTAGTTCGGCTAAGTACGAATAAAGATTTGAGTGTGCGTCAC
AATTTACAATTTTCGTACTGTGCCATGAGCGGCGCTGGGCTGCGCAATTGGCGGTGCGTTCTCTGCGTGTGTAGGAAATGTTAGAACTGTTTGTGAGTGG
CACGTGCGATTTTAATGCTGTGTGGACTTCTGGTTGAACGCTCGGCGTCTGATTCCATTGCAGCGGCGAGATCGTCGAGGCTAAAGCTACTCCGAGTGCT
GGCGACAGAGATAAGGGCGGCTATGAAGCAGATGCGGTCGGTTCTCGGTCTGCAGCACCAGTCACGCCATTACCGCTGAACGCTCGAGATCTAGCGTCGG
AAGAGCGACGTCCCTCGCAGCAGAAGGTGCTGCGAAAAGACGAGTTCGGTCGTGACGTGGAGGTCGTGGTCGACGAGAAGCGTCGCAAGAAGTCCGAGGG
TGAGCGGATGGAGGACAGAAAGAAGGAAAAGAAACACAAGCATAAGCACAAGAGCCGCAAGCATTGCCGCAGTAGGAGATCGAAATCGCCGAGTGCGCAG
GGTCAATTTGTTGGGACACCACCGCCGCCAGATCCGTTCCGTCCTCAGGTACGTGCTGCACCTGTGACTGTGCTGGTGCTGATCAACTGGAATGACTAAT
TGGCATTGATGCGGCGTCTTATTAGCTTGATGAAACACGATATGGACGCTCGCAGCGACACCAGCGAGAGAGGAGTCTTGGTCGAAGTCGCAGCCGTAGC
CGGCACCACGCACACCGCCGCACTCGAAGCCGAAGTCGAAGTCCCCACGCCAGAAACCACAGTCGCCACCGCCGCCGAAGCTCTTCGCGAAGTCGTAGCA
GAAGCCGAGCCCGAAGTCGAAGCCCACCCTCTCGGTCTCGTCGCCGGCGCTCGTCGGCCTCCGTGGAGCGCAGGTGGACACATAACGCCTTCGACGGTCG
CAGCCCAAGCCCACCACGACAAGTTGATCCACTCTATCGTCCTGATCCTGAGGCCTGGGTATCACGTGCAGGGGGTATCTACTTGCCTCGCAAATAGCTT
CATCTCTCGGAAGCGTCGTTCCAGTTTTCGCGTCGACTGAAGGCAGTAAATGAGTACGCTCCTCCGGGACTGGGATGAAGGTGTGCAAGCTTGATGTTTA
GCTCTTGTGGAATGATACGCATTGCTTCGAGTTGCCTGGTTCGACGACCATTGACTTCGCCGTCCTCCCTGTTCCTCTTTCAGGCTCAAAGAGCAAGCGC
AAAAAGCTTCTTGAATGGTTTTGCAGTCGTTTTGACCAGACACAAGACGGTGGCGGTTTGCTTGAGAGTGAGTGTGGCGCAGATATTGCTCTCTTCTTGC
CGCGCCTCTTATCATGGATGCAGAAAACGACCGTGACTGCAATTGAAAGGACTAACGATAGCTGCGGTGCCGCGACAAAGCCAGAAAAAGTGAAATGTTT
TGCCCTCGGTGAGCAAGTGGCTTGCCTGAATATATTTTTCGGGGCTGCAAATGCGCATGCATATTATCGTGAATTTCAGCACGCGGATGGTCTTCAATTG
GTGCTAAAAATCGCGGCCTTGCAAGGCAATGATCCCCAAACGCAGAAACCACTTGTGCCAACCACCAACCGAGAAACCTTATTTCGCATCATCCTACGGA
TCTCTAAGATGAGTCGACAGTGCAAAGAGGAAATCAGTTCTCTTGATGGCGAGTTAGCTGTGATTCATGGGATTTTAGCCAGCGGTGACATTGATGATTG
GAAAGTTGAGTCTCGTGTGTGGACTCTTTGTCGAGAGGTTCTGCTTGAACAGCTCGTAGGCAACCCCAACAGTCTTGACCGAGCCCACGAGGCGATTGTG
TTTATGCTGAATCACTCAGAAGTGCGCCTTCAGCTCTTTGGGGCACAGGTACATAGGCTTAGTGTCGCTTGCTCCTGCATCAATTGGGGCTCAGTATGTT
GGGTATCGTTTCTTTATGGCACGTCGGTGCTAGGTTCTCCGAGAGTTGATCACAGAAGGATCATTTTCGTATGATCCAGAGTATCGTCGCCGAAAGGAGT
ACGATCTTGTGCCTCTGAGCCTGATCCTCTTCAATTCGACTGACGTATATCTTCAACATGAGAGCCTCGAGCTTCTTCACGCTCTTCTACAGTCGAAGCA
CTTGCAGGTTGAACGTTTATAATCCGCAACGTCTTCTTGAGGAAATTAACGCGTTTGAGTGGCTGTAAAAGGATCTCATTTGCGAGAAGCTCGTTTGCTT
GGTTGGCGACAGCGCCAAGACCCTTGATGTGTATGATTTTGCCTCCGTTCTGCTTATTATTTGAGGCCCCACTTACGAGTTTTATACTGGTGCTCTGATT
CCAGCAAAGTTGAAGAGCGCTTCGTCTCGATCGAAGACACTACAGAGTACGAAACCTATGCTCATCTCCGTTCATATTTTGCCCGTGTATCCCAAGCCGT
CAACACTTTGATGCACTCAAACCGGAACTTGCTGCCGATTTTGGTACGTTCATACTTCGAAGTACCGGTCCTTTTGTAAGCTAATTGCATGTGCAGGTTG
ATCGGCACGGTCTACTCACACCTCTGGCATTCTTGCTCGTTGTTGAGCGACCTCACTCACTGAAGTGGCATGCTGCTGCCATAAGCATTCGATACATCTT
TTCTCACCATTACCAGGTAATGAATGAGCAGCTTTACTGACAGGCATTTGCGCTCGCTTGTATTGACCACTTGAGATGCCGTTCATGATGATGTTAGGCA
GCAGCTGTGTGCCTCGCCGAGCTCTTCGAGGTCCCAATGGCTGAGCTGCTCGTGTGGAAGGATAACGTGGCGATGATGGCGAACAGCTCGCCGAATTCCT
CTTGGGCGACGATGCTCATCAAAGCCATCTTGCGCTCTGGTTTTATCAGCGTGGATGGTACCGCCCGCTATCTCCGAGAAAGCAGTCCGAACAGACCGGA
GCTGATCGTGCCCTCAACGACGTCGAGCACAGTGTTGAAACAGCGGCTCGAGACTACGTTCCAGAGGTAGTATCTTGCAACAACAGCATTCTTTAATCCG
TTCCGCTCACTCCCTTCGTGTTGATACAGCTGCAAGTGCAAACGCGAGTGGGTGAAAACGCTGACGACGCCGAGGAAATGGACATCCTAGAGGCCCAACG
CGACACCACCTGCGTATCCAGCTACAAAAGCATTTCGCCCAATTCCGATACGTATCAGCAGCGACTGCAAGTAGCGACAGTTGCAAGTAGACACACAAGC
TAGCAATCGACGTGAAATTAATACTACTGGGGCCTCCGACCCTTTCCGCCAAGGTCTTCTTAGCTCTCCTCGGGCGTGTAGTGGTCCTCCAGGAAGCGTG
AGAGCGTCTGCAGCTGCTCTGACACGACCTTGACCTTCTCGCGGCTGATCTCAACGTCCTTCTCGGCGCCGTACGTGCTGCGCGCGAAGGTGCGGTAGTC
CGAGACGAGGTGGATGTGGTTGGCCAGCTCTGTGTGGATCTCCTTCACGAGCTGCAGGAACTCGGTGCACGCCGAGTTGAAGGCCAGCGACGAGCTCTCC
TCGGACGACACGCGTGGCGCCATGAGCGACATGGCGGTGGCAGCCGTGCGCAGCGCTGTCACCAATTTCTGAGCGGCAGAAGCAGTACAAGGTCAGTCGG
GATTTTACGCGCAAAAAGCAGCAAGTGAAGACGGACTTTTCAGGCAGCAGCCTCACCTTTTCGACGGAGTCGAGTGCCTGTAGTACCTCGACATGCCGCG
AGCTGGACCACGGGTCGCTCACCTCGGAGAAGTGCACGCGACTGTCGCCCTCGCCCTCCATGCTTGTGCTGTGGGGAGTGCGAGCAATCCCCTCAAATGC
GTTTTATCCGTTTGGACAGGCTATACCCGTTATACCCGATAGTCTCCATGCATCGATTTCAAGAGTGGAGATCGACTAAAGCGAGCCGCCTCTACAGAGT
CCGTATAGGCTATCCGGATATTGCTGCCGTATGCTTGCAGCGTTGACTCACGAGGGACTCGGCCGCCATCCGCTCCGCTGGCGCCTTCCGGTGCAATTTA
GCGCAGGTACTGTAGATCAGTGACCTTCGCACGTTGGGGGTGGTTTGGTGGAGCCTCGCAGCTGATTGCCATCTTGCTTCAAGCTCGTGCTCTTGAGGAT
AACGCCACGTCCAGATGCTACTATCTCCAGGCTCTCGATGCACGAACGTCGACTAACCTTATCATTGCGATGCGCTTGTGGTGGAGAGAGGCGGAAGAGT
GCGTTGCAATCGTCCGCCGCGCGCTACTTGTCCGGTTGCGAGCCTCGTGCTGCTTGTGGTGGTGCGGCGGCGCGACGACTTCGTTTAGGTGACCCGCTGC
TAGCAGCCTGCTAGCTCTCTGCTTTTCGATGCGTCGTTTCGGCGTCGTTTCGTG