Description :
From Genome Similarity Track
Location :
contig_15:29524- 30726
Transcript NameFunction/comments
g3342.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
TCTTCGTTGTCGTCGTCATCCGACTGCGACAAATCTTGATCCGTCGTCTCTTCATCTTGAATGACCACCACCTCCCTCTGATGGTAGTCGCGTCTCCCAC
TGTCGAAGACGTCTTCCATGAACTGCGCGTCGCGGCTCACCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTACCC
CAGGAACCGACAGCGCACTGACCGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGGCAACCGAAGACCTTGAGATTGGCCAGC
AGCGGCTTCTTGCCCGTCCAAACTTGGTGCGGAGACTTGTCGTGGCTGATGGCGCGTGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCTT
CACCCCAATACGTCTTGGGCAATCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCGGCGACTCCGTTTAGCTGAGG
CGTGTACGGCGGAGTGAACTTCTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCACCGGAGGTGTACTCGCCACCGTTGTCGCTCCGGAGTGTC
TTCACACGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAGTACACCATGCAGAAGT
GCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACTTG
CTTCGCACGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCG
ATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGC
GATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAG
ACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGTAAACAGGTTGCGCGACAGCTTCGGG
AT