Description :
From Genome Similarity Track
Location :
contig_58:29522- 32540
Transcript NameFunction/comments
g8829.t1hypothetical protein
g8830.t1hypothetical protein

Sequence
3018 bases(100 bases per row)
TTCACATTTCGGATCGGTTGGGTAGAAAACAACGTACATTCCTCCGTATATGAAGTGAAGCAAACACCAGTAGGTACATGTATTGGCAATACTGAAGTAT
TACGTGGTCATTATCGGAAAATAGTATACTGCGGAGATCAAATGGCACGACAGTGCCTCAATTAACTACGGCAAGCGGGAGCGAGCGCACGAAGGCGGAC
CCAGCGTCAAGCTTCACAACCAGCCCTGCATTGCTGTCGTCATCCACACTCGCGAGCGGAGCATACCGCGGGAGCGCCCAGCCAAGCTGATTATCAACGA
TGTCATATGGTGTAGGTTTGGGCCATGTTATACACTTCGACCTCGCGTCATCCATTTGCACAACGCTCTTGGTAAACAATTAGTTGTCCGTGGAAAGCAA
TACAAATTACTTCTCCAAGTACTCGCAAGGATGATGATGCGTCTGAGCTTCGTTGGGCTGCTAGCTGTCGCACTCCTGGCCAGTACCGATACGGCCTCAG
CGCAGAAGCAAGCGGAGGTTTTTCACCAGGATCCCCAGACCCTGTCACGTTCACTTATCGAGAGCCACGACCAACCCAGCACAAATGGATTTCACTTCAC
TTTCACGAAGACGACGACGATGAAGACAGAGCGATCCTTCCTGGCTCCGTCATTGAAAAGACCAAAGCGTTCGCTTCTCCAGCCACCACGGAGAAACTCC
AGACCTGGCTAAGCAACGGGAAATCCATCGACGACGTCTTCATTGGCTTGCAGCTTACCAAGGCTGGCGATACACTACTAGACAATCTGCAGTTCACGAC
GTGGCTCGTGTATGTGGACGATTTCACTGCCAATAATCCTGGCAAGACAACGTCAGCGATCGCTACACTCACCACTCACTACGGCGACGAAGCGGTCGCG
AAGATTCTCGACGCTGCGAAAAAGGTAGCGGGGACGAAGGAAGTGGCCACCAAGTTGGAGACTGCGCAGATGCAGACTTGGCTGGCGAGCGGGAAAACTG
CCGACCGTGTTTTCAAACTCCTGAAACTGGATAAGGCGGGGGACGGCATCCTCAGCAACCCAGCCTTCGCGTCTTGGAACACGTAGCTGAAGATTTCCAA
TAAGGCCCATCCCGGTCAAAAGACAAGTACCTTCGCGAAATTGACGTGCAATACGGCGAGGTGGGTGTATCTCGGGTAGTCGAAGCTGCATTGAAGGCCA
CGAGTTCCTCCGACATCGCGAAAACAGTACAAGCCGAGCAATTCGAGCGCTGGATGGCCAATGGGAAAACTACTGATAATGTTTTCAAGCTGCTGGCACT
TCACAAAGCAAGAAAGAGGCTTCTTGGGAACCCTCTTTTGAATACCTTTACCAAATACATGAACACTTACAACAAGGGGAACCCCGACCAGGAAGTCACT
TTGATAGGGACGATAACGACTTACTACGGGGATGTACGTCTAGCCAAGTTACTTGCAGCGGGAAGGAACGTCCCGGGCACGTCGAACATCGCCACAAACT
TGGATGCTGCGCAGTACAAACTCTGGATGAGCGGGCGGAAAGACCCGGACGATATCTTTACGATGTTAGGCCTAGAGAAGGCTGGGAATGGCCTTCTTTC
CAACCCGCTATTCACCACGTTTACAAAGTTCACGGACGCCTATCACGCCAAGCATCTTGACATCAAGATGACTACGAATTGGATTGTGAGGACCCACTAT
ACCGATTTTGACGTCACTAAAATGATCCTTGCAGCGGAGAAGGTGCCAGTGCCCAGAGCGCTGGAAAACGTATGGAGGCTGTACTGTTCAAAGACTGGAT
GAAATCTCCGGATAACGCGTTCAAGGCACTCAAACTTGAACAAGTTAATCCCTCAACGCTGTTCGAACGCCCGATGTTCGCGTATTGGATGAAGTTCATG
GATGATTTCCACAAGGCTTTCCCGGTAACAATATCCCTCGGACCGTTCTAACGACGGCCTACAAGGACGAAGATCTGGTAAAGGTGGTCGAAATGGCGCA
AACGAACCCGAACTCGAAGGATCTTGCGAACAAGTTGGAGATAGAGATGTTCAAGCAGTTCATATTCGCAGAAAAACAACCGATCGATGTTGCCAAACTT
CTACACGTTAGTGAAAAGACCGATGCGAATTGGAAACTTTGGAAGAAGTACATGCAGGACTATCACAAGCACCACCCGGGAAAGGTCACGATCAAGTCGT
CCACGTAGTTCCGAGAGACCGTAGATTCGCGTTTCTTGTAAAGCACTTCCGTCGTGCTTTCTCTTCTCATGAACGTAACATAGCATATAATCCTTGATAA
CCTGGAACTTGACGTAAGGTGTCAGGTGTCAGGTGTCAGGTATCAGCCTTAAACTACACGTGGATGTACCCAGCAACGTTGGAGGCCATAACCATAACCA
TACCTTGCTACTTATGTGCTATCATAGCTACCCTTTTCGACGGTGTGTGAGAGACCCTACTATGCAGATTCAAGTGAACAATGACTTTAGTGCGCTGTGT
AATTGCCAGGAGGTGAGGCAAGTCCTATTGTAGTTTTGCTGCACGCCTGGTGGAACAGGATTTATTGGTGTTCTTGTTTGTTCCTCTGTCCGTTGCATCT
AGCTGGGAGCCAAGAGGTTTTATGGTCAACCCGTTACCAAGGAATGTCGACCGTCCCGAACGGGTATTCGCCTGCGTTGGGCGTGGAGTTCGAGCAGAGC
GAGCTGCGGATTGTGGTCTTGTTGTACACATCACAGTCGGTCTCAGGCTCGATGGCGACCCAGAACTCGCTGTCTCCGCATCTTCTTCAAGCGCTTGCCG
ATATGCGGGTGGTACACCCCCCAGTCGTCAGCCGTGAGCGTGAACTGCACGCCCCGCGTCTCACCTACTTCCAGGCGGATTTTGGAAAACTTCTTGCGCT
GCTTCATCTCAGGCACGTTTGAGGAACAACATCACGGCCTCTTGCACGACATCGACCCGCTGTTCGTCACGTCCATGGAGACGGTGGTCGAACTATTCGG
GTCCTGGATCGTGTTCTT