Description :
From Genome Similarity Track
Location :
Scaffold_1875:2952- 4609
Transcript NameFunction/comments
Phypl_g14309hypothetical protein

Sequence
1657 bases(100 bases per row)
TTGGGTAACAAATCCCCAGGGATCCGCCGGGTGCGTTGGGAGACCGGCTTTGAGCCGCCGACATCGAGGTCACAAACCACTCCTCCGGCAGGCGACGGCA
AGGCGTTACCTTCACCGAGGAAGACCTTCTTGTGACACCGCAGGATGATGCGGAGAcgctcttcgtcctcgggGCCTGTCTTATCTGGGTCACCAACAAC
TGcttcgtcgatcttggcctcggATGTAGAAGCTCCGCCACCATCCGAtgtgtcgtcgtcgtgatcCGAAGGCTCGGGGCTGTCAGGACGCTCAGTAGGT
ATCTGAGGCCAGGGGCGCTCCAAACCAACATCCCAATtgcacgccgtcgcccgGTTGACCGCGCATCAAAGAACTCCTCGGGGACGTGCCGAAGCCACTC
AACTTCGTCTAGGATCTGAAGACAAAGCACCCTCCGAAAGACCTCATCAGCGCGTCTTTGCGGAGGCGGGTGTGCACGATcacttcctcctcgagcCGGT
TCTGGATGGTGTCTTCTGCCTCCTGGAGACTGCAATTGTCGCCGTCCATGCGGAGATACTCCAAGACATCCGGCCGTAACGTCCTCCAAGGTGGCCTTGA
TCGGAAGAAACTTCACCAGAGTACCGTCACTGCGAGGCGGATCTGCGTCCGAGTCGATAGGCCGGTAGTACTGGCTCCGGCGGTCGATCTGGGGCTGGTA
GTCCCGGGGACAAATCTGTTGGAGCCCGTCCGGGGTCGTCCGAGAAGATGGGAGCGAGTCCCCCTCCTGGAAGTCTTCCACCTCTAGATCCTTCTTCCCC
GAGGACCCGAAGTCTttctccgcctcgtcgtccacatCCTGGCCGTCAAAATTCTCCTCGGAGTCCGCGTCCTGGCCGTCAAACTTCCCCTCGTCATCCG
CATCCTGGTTGTCAAGCGTCCCCTCACCATCGGAGTCCTGGCCATCATGTTTCTCATCGTCATTTGCGCCGCCCTGGTCGGCCCCTGAGGCCCTCCCAGC
CCCCGAGGGCATCTCGGTTCCTCTGGAATTCCGGGGCCCCCGTTGCTCAGCAGCCCCCGAGTCTGATTTAGACACCCCATGGGTGGCCGACCCAGAGGGG
GGCGGAGCCGAGGGAATTGACTTGCCCGCAACCGATCCCGACGGGGCGCCATCACCGACTGACGAAGGTGGGGCCTGGGAAATATCGGTAGCCTGATCCG
ACGAACCCCCGGCGCCACTTTCCGGAGGCGTTGGCACGACAGGAGGCGGGGTCGGCGCGGACAGAGTACGCACTACCATCAACGAGACGGTGTACGGGAG
CTGGGTCGAGGTGAAGTAGGCGTCCAGGTGCTCTTGGAACGCCGGAATGTCACCCATGATGCTCGTGAGACCCTGCGCTCGGAAGTACAGCGCAACAGCC
GCCGAATTGCACAGCGCCCGAGCCTTCCGAAGCTCCCCGCGCAAGCTCGAATTCTCCAAGCCTTGGTTCTGCATCCTCTCCTCGAGACGGGCGACTTCCG
CGTCGTGAAGAGCCTTGGGAACGACAGAGCCCGGGGTCGTAACGGGCCTCGTAGCGAGTTCTTATACCGCTCGGTCGCGGTCAGTTTCGAGCTCCAGGGA
TCGCTGAGTGGCAGTTACCGATTCCTGCTTCAGGCGTGCGACCTCCGCCTCAGACTC