Description :
From Genome Similarity Track
Location :
scaffold_5:295132- 297787
Transcript NameFunction/comments
g8153.t1 HECT E3 ubiquitin ligase, putative
g8154.t1hypothetical protein

Sequence
2655 bases(100 bases per row)
AACAGTGCCAAGCGCAAAACCTGCCTCATGTGCGGCACCAGCATCGGGTTCCTCATGAGCACGGAGCTCGGACGCCGGAAGAGCTCGCGGATGCTGCTAC
GCAACAACAGTCGAGGCATCACGGGCGCCGACGTGGCCGGTGGGGCAGGAGAAGAGGAGGATATGGAGGCGTTGAGGGTGAGGCAACGCGCGCTCTTTAA
GCGCCGGATGAACACCATGGCGGCCAGGAAGAGCTTGTCGCAAAGACAGCGCGGTGCGTTCCGACGACGCCTTTGGCAACGCAAGCAGTTGTCCGATGGC
AAGTTCCATTGGGTCCGGCAAAATAGTACGGATGCGGTTGACCCGCTACCGGAGCTGCAGGGTGGAGATTCAGCGCAGGCGACGCTACCGTCGACGGCGG
AAGCGACGAGTTTAGCGGGGCCCAACGGAGAGAGCGTCACAGACTACCATAACCTGCGCTCGCAAGGCTTTGTGTCGATGTACGACGCTACGGGGCGGCT
GACGTGGACCAAAGCCGATGAAGTGTCGATTGACATGGAATCGTTTGGGAAGGGGCTTGACAATATTGACTTTGAGGTGGGCAATTGTGGCGATTCGTGC
ACGTGTGTACTTGCTTGAGGTGTTCACGGTTGTGCTTGTTTGACTGTAGGGAGTGATGGCACTAAGTTTCCGCATGAAGAAGCAGTGGTTCTTGGTGCAG
CTGTCCCGCATTGCTACCCCAGTGACTGAAGCCGTCGCCAAACTGAGTACGTCTCCATATTGTTGAGTGCCGTGGCTCCTGCAATGAAGCTAACCTTTTG
ATTGCCCACACTTGAAGCAGTGACGCGGGAACGGATCATTCAGCAGTCGCTGCAGCTTGCTGAGGCCCCACCTGACGCCCTTCACGCGTATTTGAAGATT
ACGTTTGATGGTGAGCCGGGTATCGATGCAGGTGGTCTGCTACGAGAGTGGTTCGGAATCGTCTGCAAACAGATTTTCAGTGAGAAGATGGGCCTCTTCG
TCCCCACGAAGGGCGAAGACATGAGCTATTGGATTGACCCGCTCTCTGATGAGAAGAACGAAACCCACCTGAAGCTGTTCCGCCTAGCTGGTATCTTGAT
CGGCAAGGCGCTTTTTGAGGGTCTTGTGCTTGATGCCCACTTAGCTCTGCCGTTGCTAAAGCACGTGCTTGGTATTCCAATCTCGTTCTCCGACCTTGAG
TTCCTCGACGAAGAGCTGCACCGGAACTGCAAGTGGCTTCGCAGCAACAATCACGTGGAAGCTCTTTGCCTGACGTTTAGTGTGATGCTTGAAAATGGTA
CTGAGGTGGATCTCAAGGAAAATGGACGCAACGTCGACGTTACTGACGAGAACAAGGAGGAATACTTACGGTTAGTCCTCGAACACCGCATGCTGGACAG
CATTGCTGACCAGTTGCAAGAGTTCCTCATGGGCATCTACGATGTGGTGCCGAAGGCGCTGCTGTCTGTGTTCGACTACCAGGAGCTTGAGCTGATCCTT
TGCGGCATCCCCACTATCGACACGGCTGACTGGAAGGCGCACACTCACGTGCGCTACATCAAGCCCGAGGAAAACAGAAAAGGCAACATCACCGAAGAAG
AGCAGAACGGAGTGCTGCAGTGGTTTTGGATTGTTGTCGAGGGTCTTGCACCCGAGGAACGTGCTCGGCTGTTGCAGTTTGTCACTGGAACCAGTCGCGT
GCCCGTCGAGGGCTTCCGTGGGCTCATGAGCTCCAGCGGTATCATCCACCAGTTCACGATCCAGCTCGTGACGCGGGGCAAGAAGGAGAAGGCGGACCTG
TTCCCCAAAGCGCACACATGCTTCAACAGACTCGACTTGCCCATGTACCGCGACATGGAGGAGCTGGAACGAAGCTTGACAATGGTATCTCAAATGGAAG
TCTTTGGCTTTGGCCTCGAGTAGAGGCAATAACAAAAGTGCTATCCAATATATATGGCAGCAACTCGCGTGTGTAAGCTGTAGTTCTGAATCATTCAAGT
TGCCGTGACTTACAAAAGTGTTCGGAGTTGCGTTATTTAGTCTGGTCCTTCAGCTTGGCAATATGCGCAGCGACATCTTGCTGCAGCATCTCCTGATGGC
GTTTATCTCTGCGACCTTGAGAGCCGTCCAACGACGAACTTAGCCACGCAGGCGAGGCTGCAGCCTTCTGCTCTCCCGGCTGCTCCTTCTTCAGAACGGC
CAAAGCCGCCTCGATCTTGCTCTCACTTGTAGCCAACTTCATATTTTCTTTTGTTTTATCATCAGCAGCACTTGCAACCGTTGCGGCGCTCTGTCGACTA
GCCATAGCCTCCTCCTCCAGTCGTCGGAGGCGGTTGCGCATTTCCTGGATAGCGGATGCCAGCGCCGATTCCTTGTCCTGCTGCTCCTGGACGGCATTTA
TCTCGCTCTCTACCTGCTCCATGCGGAGCGCCTCGTTCTCACGGTCCATCCGTCTCTTCACAGAGTAGAGGTACAACCCCAGCACAGTGCCAGGCCCGAA
GGCGAACAAGCCGTAGAAAAGCTTACGTCTCGGAGACAGCAACTTCCTGCGGGGGGCAAACAGCACGGCGACATCAGATACAAAGCAGTTCTAGTGTTAT
AGTTGGCGTTTACACACTCAAGCGCGTCCGGAGGCGCGTCCGAGAAGAGCATCTT