Description :
From Genome Similarity Track
Location :
Scaffold_1425:2951- 8491
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1425-fgenesh-gene-0.0Phosphatidyl inositol kinase (PIK-A)
Pytar_ATCC12531maker-par_contig_1425-snap-gene-0.3Conserved gene of unknown function

Sequence
5540 bases(100 bases per row)
TTCGACGGATCCAGAGACGACACTGCAGAAGGTGCAAGAAAAATTTCGGCTCGATCTCACCGATGAACAGGCCGAGCAGTTTTTCCTCGGACTCATCAGC
GACAGTGTCACGGCGCTCTTCCCCGTGTTTGTCGAGTACATCCACAAGATTGCCACCAAGATCCGATAGACTGAGTTCAGACCAACGTCCAGTTTCGTCT
GCAGCGAAAGATAAGAACTTCTCTTCCCTCGTATCAAAATACAACCAAGTGCAACCACAAGAAAGAGTATCGTCATGCGTGTTGGGTGGGGGACACGCGA
GTGGTGTGGGAAAATTGCGTGTTGGTATTATCGCTGCCACCCATGGAGCAGCGAGGTGTTCACGGCGCGGAAATCCTCGATGACGGCAAACTGATCAAGC
TCTCGCAGTCGCTGGCCGCCCACGGTGTCGTCAGGTCGCCCTCGACCGGCGTCCTCGAATTGGGCATCGATCAGGCTCGATAACCGAACCGCCTTGAAAC
TCGTGCGTGGTGAGGACTTGCATGGCGGGAGACTGATTTGAGCTGGTTGCAGTTTAGGCGATAGAGACTCGTGTTTGACTGGCATCGAAGACACATTCTT
GACGGGCGACTGGATCGGGGGGAAGCGGGTGCGTTGTGATGTATTCTCGTTCTGATTTGCAAAGTGACGCTGCACGATCGTCGGAAGATCGACTACTGTA
CTCACGAGCTGAAGCTCCTGCTCATAGGTCGTGTCGTGGAGCCGTTCGAGCGCATGGTCAACGTTCCCCACGGCATCGGCCAGCGCACAGCACGCGACGG
CCTCCGAGGTAAGTGGCAAGACGCCCCGAATGCGCGCCACGTGGCGATGGTACTCTGTCTGCGTCTCATAAAGATCCAACGACGTCGCGACGAGCTCTTC
CCAGTAGCCAATGAACTGCTCGCCATTCGCGGGCAAGTATCCAAGCCGTTTTGCCAGCGAATCCATCGAATGCTTGCGTCGAAGATCCGGCCGGTCCGCG
ACTGGAGAGAGCAACCCGCTCTGTGTGCGAACGGCAAGTTTCTCGCTAGGCGAGACGACTCGCATACTCGACGTTCGATTGAACTGCCGCCCGCGAATCT
GCTCGAGCTTTTGCATGGCAATCGTCTGTCGGTACAAAAAGGCTTCGTGTGGGTCGATAATCGTCGCCGACCGTCGTCCGTGCGTCACCCCCGGTGGAAG
TCTGCTCACTTTCCGGTTCCCGCTTCCATCGACAAGATTCGTGAGCGACGCGACCACCGACGACCGGTGACGANNNNNNNNNNNNNNNNNNNACCGGTGA
CGATCCGGTGAGCGAGCAGTCATTGAATCCTCAGCACCACCGTGCGAAGCAGTGTCGTGCTCGCCTCCTTTCTTCTTGCGTCGAAAGAGCCGCTGCAATG
ACGTCACTGCGCGATCGTACAAGTTTTGCCGCACGTTGTCAACGATCCGCGCGACGGGTGTACGCAAGAGCGAGGCGTACTCGTCATCGTAACGCGCGTG
GATTTCGGTGAGCGTCGCAAATGGCGCGATGTGGCGGTTGATGTTTTTCGCGCGCTTGAATTCTGCGCTGCACTTGGTGCTGTCACCGATCGCCTGGAAG
CATAACGCGTGGTGGTACAGTACGCGAGCGAGCACGCGCGAATCTTTGGCGTACGTGGCCGTGATGGCGTAAAACTCGATCGCCAACGCATAGTCCTCGT
GGTGGAAGCACTTGTCGGCCAGCGCGCCCCACAGTTGAAGGTACTCGTGGTCACTCCACGTGCTTCCGTCTAGGCATGGAAGATCGCTTTTGTGTGCCTG
AAGCGTCTTGAGAAGCTGCGAGAATGTTGTCGACGCCTGCAAGAAGTCGCCGCTTGCCTGCTGGCAATGCATCAGCATCAGCAAGTAGTCACTTGCGTCG
TACGGAGGCGGCGCCCCGCCTTGGATGACCGGTGGTGACGGGGTCCCTGCTTCCGAAGGCGCTGCTTGGCTAGTTTCGTGGATCGCGACAATCTTGTGCA
AGCACTCGATCGCTTCGCTGAACGTTTTCAGGCGACACAAGATCTGAAAGTGGAAGAACAAGACGTTCAAGCGGTCCTTGTCGCAAAATGAAGCAAACTT
GTTGAACAGTTCACGGACAATGTCGTCGGCGTGCTCCAGGTTTTTCATGGTGCCGTCATCACTCTTTTTCCAGTACATGCAGATCGCGTACCGAAGCAGT
AGCAGCGGATCGGCAGCGCTCTTCAAGAAGGCAAACGCGCGCGTCAGCGCCTGCAGACTCTTGCTCAAGTGGAAGACCGCGGCGGGCAAGAACTTGCGGT
GCCTCAGAAACACATCAAAGTGGGCGTTGCCAAGCGCGTTCCAATACTCGTGCAGACGGGCAGACGCGCCATCGTCGTGGACGACCGCTTCGTTTTCCAA
GAGCAGCACAGCGGGGAGACTCGTGGCCGGCCAGCGTGCGTAGCGCAGGCCCAGCTTGACGAGCGTCGCAGCGTTGGTCGGATCCTGAAGGAGCTGCTCT
TCGAGCTGGAGACAGCTCACTTTGTCAAGGAGCTGCTTGCCATTGGCCCACTTGTGCCACTTGGCGGGGTACGACGGGGACTGTTGCAGCGCGGCGATTT
CTTGTGCGGATCGCTGGCGGTGCTGCTGATTCGGCGTTGANNNNNNNNNNNNNNNNNNCACCGGAAGAAGGGAGCGAAATCCTAGACGCCGCCGAGAGTT
CCACCTCTTCATGGAGTGGCGTTGGCACAGCCATGTCTTTCGTCGAAGTCTTCCGTCCCGTTTGAGACTGATTAGCAGCAATGCCCGCCTCCTCAGCCAC
AAATACCCGAGCTTCTTCGGTCATGTGGAAAAAGTGAATCGTGGATCGACGCTGACCTTCTCGCTGACCCTCCATCATATGGTAGCGAGCAGTTTGGCTT
GACGTGGCGTCTTGGGACCGTCGCTTGCGGCTCATTAGCTTTCCCTCGTTGGGGGTACTTGTTCTGGACGTTGACGACTGAGCACTTTCGACTGGCGGAA
CCGCTGCGGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCCATCGCAATGGCCGAAGAAGCAGCATCGATGATAGAGCCCCGGCGAGA
CATGCTGGCGCCGCGTCGCAGTGGGGATGGTTCGGCCGAGTGTGGCGGGGTTGTCTTTTCCTTGCCTGGCTGCACTAGAGGGAGCACCTCCACTTCGACA
ATCGGATCTTCGGCGGTCTCGTCTACCAGCGTTATCACTGGCGGGATGTCAACGCGACTCGGCTCGTCCACCGACTGATCATGAGGCTGTTGCGCGTCCG
ATTGCTCATCTTCGTCGGGCGATAGCGCTTGCTCAACAGGTGCTGCCCAATGCTGAGTGATGTCATCGATGCGTTCTGTTCCGCTGTCGTGGAGCGTGGG
ATCAAAAACGGTCTCGATTCGCTCTCTAGCCACAGTCGACTCTTCTTCCCAACATTCGACGCGCGGCGAGCTCATCGGCTCACCTTCGTGAATGTCATGA
ACCTCGCTGTTCTCGTCTTGGTCCTCCGGGTGGATGTCAATCACCTCAACGGTCCGTGCTGATCGCGGTGTGAGCTGCGTGAAGTCATCACGGGTCTCTC
CGCCTTCAGCAGTTGCGCCCAGAGTATTCTCCACAGTGACTAGAGCGGCAGGAGCGGGCAAGCTTACGTTCTCTGCTACCGTGTCTTCCTCTCGCGCTGA
CGTTTTCGGGCTTGGTTCAGTCCGTGTGGTATCCAAAGCTGCAGGAATCGTAACGTCAGCGAGTGGTTCTGGCAAGACCTTCACCGTCGCCAGGTCACGA
GGCGATGGAAGCACGGGTGCTGACTTGGCGCTACTCAACGGACGCTTCGTGCCGTCCGCTCTACCTGCCGGTTGTGGCCGCCGATTCTTGGTGGTCAATG
TTTTTCGTTTCGACATCGCGATTGGTTCCGGTGACGGCGGCGCGTGCTCTGGCGTGTGGAAGCGGTGGTCGGGGCGTTCGTGGGTAATCTCGACGCCCAT
GGCTTCATCAAAGACGCCTTCGGCTTTGAAGACGCGGTTCTGGTTTTCCACGATCGTCTTACGTCTCAGGAACTGCTCCGCTTCGGGCGGGGTGCCCGTC
CCTCTCACTTCTATCGCAGTGGCCGCGTGGGTGGATGATGAGATCGCCCGCGACGGACGATGTTGTGAGTCAGGCGGCGACAAAGCGGAAGCACTGGCAT
GCGGAGACGCTTGCCTGGGTGGCAGTGAGTGGTCTATGCCAGCTGAAGATAATTGAAGACTCACGATTGGCCGCACGAGCTGGAGCCGCTGCTTGCGCTC
CTTGTCGCGGCGCCGCTGCAGCTCCGAGTACTTTGGTTTACGATCTGGCACCGCTCGTTTGCTGTGGTGCGTTATATGGGAAGCAAGTGTCGTCTCATTC
GGTTCGACAATGACCTCCTCTTCGCCCTCTTCCTCGTCGCTGCTCTCTCCAGACTCGTCGTTAATTCCCTCGAGGCCGCTGCGCCATACAGTCGTGGCGT
CAGCGTTGGCCATACGGTGTAGCAGGCTCATCTCGCTGCTCTTCCTCGACGACTTCGCCTTACTGGTAGCGTCGCTGGCGCTGGTGGAAACCACGAGACT
TTCTATCTCATGAGAGTGGCTATGGGACACAGCAATCGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGTCCATCGCGCGCTGCTGGCTCTGC
TTGTTACGGCTCGTGCGCTTGTCCTCGGCTTTGGTCAGTTGCTTGGACGACGATGGCGTCGGCCGTGGGGCCGCGCGTGGTTTGTGGTCGACGTGCGTGG
CGCCGTCAAGGATGCGACACGTGAGCCGCCCGACGTCGCGGTGGCGGTTGCCCACGATATCGAGATGCGACAGCACGCTGCTCGCGATTGCCTCAGGGGA
GGGGTAGTCCTTGGGATCAGACGAGTGCTGCGCGTGGTGGAGCTGCTCGCACTTCACGCGCGAGATGAAGAGCGCATAGTCGTTCTCGACCTCATCAGTC
GCGGCCACGCGCAGGCCAGCGAAGTCGACCGAGGCGGCTGACGTGTGGAAGACCTGGTAGATGCGCACTGTGAGAAGGCGGCTCGCGAGCGCAAAGTCCT
GGACGAGTAAGAGGAGCTTTTCGTTTGGAAGTTGCGAGCCAGTGCCACTAGCGGAAGAGTGGTCCGTGCCTAGAACTGCCCCATTCTCCAGCGCAGGTCC
ATCCATTCTCCAGCAGACTCGAATACAGGAACAAGACGACCGAGCAAATGCCCAGTGCAGTCTGGTGCGTCAGGTGGATTGACAGCAAAAGAGACCCGGA
ATACCCTCACCTAAAATTATAATGCTCGTGTCAAGAGCGCTTTGTGGAGAAGAAGCGCGGAGAACGCAAGCAACGTTACACTTGCTCGTTGGTATGAACA
CTCTGGTAATGCCCCAGTTTGCTGCTGCGCATGAGCGCCATCTCGTCTTGCTTGTCTGACTTGCGGAAGAGCGACAGCGCGGCGCCGACGACCGCGGCGT
TGCACAGCGCCCAGTTCACCCAGAGCTGCCCCACAGGAAC