Description :
From Genome Similarity Track
Location :
Scaffold_38:295080- 296695
Transcript NameFunction/comments
Phyra_79251inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
1615 bases(100 bases per row)
GTACTACTATACTGTCGTTGGACTTGGCTGGACACTGACGAACATGTGCTGATACAGACTCGAAGTACACTCTAAGTGTGTACAGTGTGATGTCAATCAC
ATTCTTTGCAGTTGCTCTGGCTGGTGCTGTTCTCGTGACGCGAATGGTAATCTCCACTTATTGATGTTTGAAATGTTTCGTCAGTGACTGACGACTTCCT
TTATGCTGCTGACAGAATGGTATTTCTTTTTCGAGGCAAACGTTTTACAACGATATGACGTCGCTTTCGGTGATGATGATCTTCGTATTGTGCATCGTTG
GCAACGCAATTTGGATTAGCGTATCAACAAAAGCGTCGTCGGCGAGCGGAACCGACATCTACTACCTGCTGTACGCGATTTCTGTCTGTTTTACGTGGAC
GATGATGACTTCGGTGTGCTTTCACTGGGGTACCGTGCTGTTCCACGACGTGGGGCCATCTGGACGTTTGTTTGTGTTCACCGTCTACGTGATCATCAAC
GTGGCGTTTTACGGTATTCAACTTTTCGGAGTGGTGAGCCTCACTGACTTTTACAAGTGCACTTACGACGACTACTTGAAGAATCCTTTCTACACCATGC
GGCTGTGCTCGAATGACTATTGCCCCGATTTGCAGCCCACTCAGTGGAAGTATGCGGTGAACAACGTGTGTAAAGACGTTGGTTACTCGAACTGGTTCTT
TCCGCTTCAGCAAAGCGCTGAGCTGCTTATCTTCCTCACCTCCGTGGCATTACTTGTGCTGGGCACGTTCGTGATTCAGCGTGGTGTGCGCCTTATCGAT
CAATCCGGCGATATTTTCGACGACCACGTGGTGAAGGTGATGAAAAAGTCGTTAATCACGTATCTGGTGGTGATCTTGTCGATTGCACTCGTACTTGGAA
CATCCTGCATCATGAACTCCATTCTTCACTGGAAGAATTGGAGTATCGACTCCGTTGTGTGGTATGTTTTCTCCATCTGGCTGCCGACATTGGTTCCCCC
AATTGGATTTCTGCTTTTGCAGTGGAACCCGCGGCTACACGGTATGAACTGGAACCCTTCGTTGCACGTGAAGGACCCGCAGCTGCTTCATCGGACCATG
TCAAGCATCTCCGAGAAGTTTGAGAGCGGAAAGTTCGCAGTTCCGCTTGACGCCACTGGGCTAAGTGATGGCTGGGCAGGCATTCTGCGTTTTCCTGATA
CGGAGTACAACCCTATTGGTCAGGAGAGTGTGGATGGCACACAAAACGTACTTGCGCTATCTGTCCAGCTTGTTTCGCCCATTCCTCTCACCCACGCGTG
CTTCGTTGAGCTCTACGTTGCGGAGAACCCTTCTCCGGACGGTGAAAACGATGTAACGGGTGAAGATTACTACGAGGATCTTCCTATACTGAGTTACCGA
CGTTCTTCCATTAGCACGTTCATCGAGAGCGGGCTGCACCAGGAAGGAATTCTCAGCCGTCGCAGTAGTCATTCGTTGTCGTTGCTTGGTCCTGGTGCTC
TACCAACCCCTCTGCCTGTTTCCAATCCTACAGCAAAGTGGTCGCGTGTGGGCTTCACAGAGACAGTTTTGCCCACTCTGGTGACTGGCAACTCTGACAA
TAGCGGCAGCTCCGT