Description :
From Genome Similarity Track
Location :
Scaffold_3:29501- 35959
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-0.47ATPase

Sequence
6458 bases(100 bases per row)
TGATACgTGACTGTACTGGCATTTCATCTCCCCACAGATTtGCGGAAGCACTTCATATGCGTCGCTGATGTCCAGAACGCCTGCGGTGTGAATACCGTTC
GAAGCAATCAGTTCGTACTCCGGTACGAACATTTCCGCACGCAACGCAAAAGCGCACGGAGAATGCTTTCGGAGGTCGTAAAGCCGAGGTTCCGAGTCGG
GTTGAGTGGACGGGACGAGTTCCACCGTGACCGAGTATCTCTCCCCATACTCACCACACAAGTCGCCGTCATCAAACGTAGCGTATTTGAACTTTTTGTG
GATAGGATCGATTTTCCATCCTCGAAAGATACTGCACAGTGGAAACTATGAGCGAaCAAATATGGAGCAAGcAGGAACGTGgTGAGCCcCGCCCTGtCGA
CcGCACACTTACCCCATGAGTTTCCGAGTTGGGAGCTCAGCCGATACCCCTGCCTcTTCCGTTCCTTCAGACGATGATGGACCTTCGGTGGTCTGAGAGA
CGGCTTCGACTGGAGGCGGAGGTGGCATGAAAGTCACGTTCTTCGAATGGCAGAAGTCGACAAGAAAGCTATGGGGATAGCATTATCTATGAGTCTCATC
AGAAGTGTACCAACACCACGACCCTCGCGAACCTTTCTCCGTCCACCTCGATCGCCTGGTTCTTGATGCACCCGCCTTGgTCCAAATAcgAAGAGAAGGG
TCCTATCCCCGCATGCAGACTATCAGTCTGTATGTCGCTTACTCAGTCCTTTGGCTATCATCTTACCACTTGGagTGGCGGGATCACGAAAAGGAATCGG
TCCCGTCGTCaTGGACACCACTGGCTCTGGACGCGGACGTGGAACAATCCGGATGTCTACCTTAGGCGCCGCGGCGCAGAGCGAACAGCAGAGCGCGAGC
GTCGCCGCCGCGCACGTAATCACCCGAGCCATCACCATGATAcGTAGCGTTCGATTCCCAGtGCCCACGTCACAACtGCATGGAGCCTCTCAATtGTCAT
AGGTCGACTTATGCAGATACAgaGGGTTTATCTACTCATTTAGTGTCCGTTGAAGTCTCTGAAAGgAaGAGTGTTTGTCGCTTGGCCATGGGGGCGGAAA
AGTGCCGTCGGAGGGGAAACCAGCACTTCAATTGATCTGACTGCAACGAGAATGGGtGGgCCGCATGGAGAGAGCGTTGTCAGCCTCGTCCAAGAGACAC
TTGGTGCACTGAAGAGGCTGGGCGAGGTGCTAAACGACGGAGGAAGCGAAGCAATCAAgCcTCGGATCCAAGCGCTGGAAGATGgCtCGGgAAAGTTGCA
CGAGATGCTCGAAAGTGTTCGGCTTGAGCGAGTCCTCCAACTCTCGTTtGACGAGATCATGGAAGCTGGAATTGTGCTGTaTAATAGTTCAAGATCGGTG
TtCAAGTCCCTGGAGACGGCGCGCGAACGACTTGGCAAGGGCGAAGTCGAACGAGTACGATTTCCTTTGCTCTTCGTGCGTCTTCTCGCTGCTCGCGTGA
TGGGACTAGCTCTTTCGTGCTCTCAAAGCGGGAATACGGTTGATTCAGGGCGACTTGAGGATCAGAGTGTCTtcATAGATGACTGCCTGGACGTACTGCG
ATCATATGGCCGCATTGGATCCCTCTTATTCCAGACTGCAGTGGTCGACATCCACAAATGCGTCGAGTATCTTACGCTTAGCAATGGCGCATTTGATAAC
GCCTCCAAAATATGGAATCGCGTCGGTTTAGCGTGCTTGGCAAAATTCAAGCAAGACGTTGAGTTTGAaGAAaTCCTACAaGACCTCTGGGACTTCAGCT
TTGATCaCATTCGCGTGCtCcGCTCATTGGAAGGGTaCAGCGGTACAGAGTCTCTAGTCAACACTATTGTTGAGGCTTtGCATGAATTACAAATTTTGAT
CCCATACTTAaCCAACAACGGAGAGACCTTAGTACAGCTGCTTCGAGACATCATCACGGATTGGAAGAaTtCTGAACGTCATGGAGACCTGGTCACAATC
GGCGATGAAGCTCTTCGTATATGCGACGTCATTGGAGCCACGCTCGAGGTGTCGCAAGCAAAATATGTTGCCGATTTTAGGCATCGTGTGCTAATGGATT
TGCTGTGGTCTCTCGGCTGTTTGGGTGACATCGACAGAGCAGAAATATGTTTCTCTCTATTAGGGAGAGACAGGGATCCATCAGCAATGCTGATAATGCT
TAAACTCTATCTAAAAATGAGTGAGCACGAGAAAGCGTCGTCGACCCTCAAACACTTATGGCAGCAAAACGAcTTGCCCACATCTATGGCAGGTGCCACG
GCGTACGTTGAGGCAAACGGCTTCAGCGAGGATTCTACTCAAGTTTTTGACGAGTTAAGCCGGCACTACGGAGATCACACTGCTGAAATCAGGGTTGaGA
TGGCATGTTGCCTAGCAAACTCTAGTGTTAGGCATTGTCGCAATCGAGCTATCGAAGAATTCATGAAGATTTCGAAGACCATAAAATCCAGTCGAAGaGa
gCAGTGAGTCTTCAATATTGTCAGTATCGGGCGGCATCGTGACTTGTTCTGCTTGCCATACAGCGACCCATCATTACAGCAGTTCTATCAACGTATGCAT
CAAACCATTCGcGACGCAACTCTTACGGCACTAAATGACCAGTGTGCCGAAgTGGGCCTAGCTTGCATTGAGTGGCATGAAAGTATACTCACAAAACTGT
GtATAGGAGGGCATTCTGTGGgCTGAACTTGGAATGGATATAGCAAGATCGTCcGAAGAGTCCTCGTACTTCATGAGGTACGCTCTGCCATTTGTCGAAG
CTCACTGATAGCATTAATGTGGAGTTCTTAGGGTGCTTGCAGCTTcGTTTCTGAAGCTTGGCAATGtGCAGGTCAGCTGGAAGTGGGCAAGCGATGCCGT
GAAAAAGGACTCTTCAAAAGCCTCGCtcttGACCTTGTTTGAAGCCTCACTCATGCGAGATGACGCCTGCTCTCAGTGcGCCCAaGTAATTGATCAATTG
AAGGcGAAAGATGACTTTGAGGAGCGAGACCTCATtGTTTTTGGATCCGCAGCTCATGATGCCGGTCGAGACGACGTCTGCTTGGCAATCATGGATGACA
TGTGCTCCATCTTCGTCAAGAAAAATACGGACACTACAGAAATCTCTCTTGGTATACTTCTACAGAATACCGCTCAACTTGCTCTTCAAATAATCACAAG
TGCTGCGCCGACAAATGGGTCTGAAGCATCGGCATCcTACGCACCTGTTTTCGACAAGTACTCGGTACACTTTGTCAAATCAGCACAACTTGTAGAACCG
CATGAGGTTGAGCGGTTTGGACCGGAGTCTGTATTTTCATGGTTCTACGCTATGAGGTAGGCTGTCATTTTCACCGGAATCGGGGAGACTTTTGACGGGT
ATCCGTAGTTTCAACATTGCGCGTACATGCAAAGATGCAAGTCATTTCaTTCGTGCCGGAGATATATCCAAAGAGGCAACTAGGCTATTTGGCGAAGcAa
GCTCTCTATTCGGGAAAGAAGCACAGTGTCTGATTGCTGCTTTGAGCGTGGAAATGACCACAATTGAGTCATTAAATGGCGAGAGACTTAAACTTGTGAA
TGAGgTGATTATGCGGACCAAGAGAGTGATTGCTCACGACGACGACGACAGCAAGCTATTTCTTGTGAGGTTTATTGAGCCAAACAgaGCCGAAGAGTGC
ACTAACGATTTTGCGacTAGAGTCACTGTGAGCTGGCAGTCCGCCTGCGTAGTTATGATTCAGATATTGAGCGGATCAGGCAGTTGTgCcAGCAAGAACT
tCcACGCCATTTCGATACCCTACTCGAGTGTGGAGGTAAGTAGGCGTGGCTGTGTATATGCATGCcTTTGTtAGTAAAGaCTACTTCTTGTAGAATtGAT
CCTTcATGCATCaaaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAaCATGTGGTAGACTCAGGCAAAGTACcGGAACct
AGCTAGTGATCTTTtCAAGAACAGGTAATTGaTATGCTCACATAGGTCGAAGTTTTTTttGCTGAAAGCACTCTGAACTCAGCCTTCAGCTTCTCcTCcA
AAAaGAAaGCTTTGATGGTGGCAAAATGAGCTACATCTTTCGTCGCCTTATAGTGCTTtCTGGATCACGCCATGATGCACTCCAGTGGTTTGACCAGCTG
GTGCAACTCGTATCGAGCGTTGACGTGCAGTTATCGGATAACGACGCGGAGTGGTTTGTTGCGAAAGCGTGGAACATGGTACGATTgaTACTATGGCAGT
TGAGTACGAGGAGCAAAATCTCTGAAAGAAGCTGTAGGGCGTGCTGCAGCATCGAAAcAAaGCTGTTGatGAGTCACAGCGCTTCTTCACAGCTGCGTTT
TCACTACTTTGTGAGTACCCGACGCGTAACGCAGGCGCAAATGCACTCATTAACTTGTCTTCAAAGCGACTGTTGGGTCATCTCTGACTGAGCTAGGGCA
CAGCTTACATGAGCAATATCAGGCCATGAAGTATCTCGACaTCACAGAATGAATACACAAACACgAACATATGCTAATCAACAAGATGGTCTtATTGAAG
TAaTCTACGACTCAAGCCTCAAAAACTTCGCGAGGAGACTGTGAGCTGATACCCATGGCATGCACCTTTGTCGCAGTGATATATGTTTCAAGGGgTGGCA
ATTCGTCTGTCACTTCCTTCTTCAACACTTTTGAAGCCCACTTTCGCTCAGCATATTCACAAATCTGCACGTGAGGTGAGTAAGGTCTCTCCTTCTTTCA
GAATACCGTCGATGACGTACCTCCTTGATATCcCGACAAGATAGACCACTTGATACGCCAGCAAGCTGCGCAAGTTCGTCGCCATTGAGTTGCTTCGCGT
AGCTGTACGTCACCAAGCACAGGTCACATGTCACGTTATCACAATGCGCATGACAACCGATGCGTACCGTGCAAAAaCAGCATGTCGTGTGCTTTCGTTC
GGTAGCTCGTACCGAATGCTGAGATCGAAACGACTAATCAAGGCCGAGTCgAgaTCTTGCTTCCTATCAGGATTCAGTCCAGTCATGATCAATACCCAAA
GCAGATGTTtGaGAAatcGAGGTGGCGTACCGATTGGTGGCGCAAATGACAGTCGTCTTCCTTGCagAAGCAAAGCCTTCGACCTTCTGCAATAGAACAG
ACAAAATgCGTCGCGAGGCTTCGTGCATTGTTCCTCCCGATCGGTCACCAGCAAGTGCGTCGATCTGTAAGACAAGAGACTATCATGAACCACCTATGAA
AGATCTGTTTGATACCACAATGCTCACCTCATCAATAAAAATGATCGCGCCGTCAAACTTCTCGCAAGCATCGAAGATAGCCGACATTTTTTTTTCGCTG
TCGCCGTACCACTTGGAGACGACACTTTCGATGGGAATATGAATCATTGGTATGCCAGCTTGTTGGgCAATGATCcTGGCACTGAGCGTCTtGCCAGTGC
CGGgTGgCCCTTcAAATAGAACGGCGCGTGGACGATTACTCTCATAGCGGCATCGAGTCTTGCGTGCGATCTGATCGTACAGATCTGGATTTTGCAGCGC
AAGAACGACCGTGTCTTCGATCTCCAGCTTGACATCGTCATACCCAGCCTACGCAATATCGATGAGTTTCTGAATGACATGGAGTGGCGAAGTCATGCGT
ACCAAGCTGTCCCAATTCAGTGCATCTTCTCCCTGGTTTGGCTCAAATACATCAATACCAAGACTTtGCAGCTGTTGAATCGCTTCTTCCTACACAATCA
TTACAAATTGCATCAACTCAAAGCTCCCGTAGgCGAATGTACGCGTGTCCGCCCCTCACCTTtGAACCGGCGGGGgTGATCGCAGGTGtCTTTTGTCCGC
GATCAACGAGAATTTTACGGCGGGTCTGGTCTCGCTCGAACTTGAAGAAGGCGTGGACGTTTGGATACGAGTAGAGCTCTTTGTAGGCCTCCACAACcgC
TTCGATTTCGGTTGTCGTTAGGTGTTCGTCTTTGTAGAAGACAAATTTGGTCCCTTTGTTCCCTTGtATGGAAGTGTCACgtAGAAATTGAAACGAGCCA
TGACCACTTGCATACAGATAATTCACGGATGGCTGCTCGTACGACTCGACGATCGATTTCTTGTTAGTCGAATCACCACTCTGGACCGCAAtAACTTCGA
TGGGCTGGTCCACGCCgCGCTTCTTCTGCAAGTTGAGCAAGAACCGACCAAGAATCGCCTCTTGATCCACGAACGGTGGACATACGAACTCGATGCGAAT
AGTCGAGACGCCATTGGGCGCGTGCATGCGTGAGATCGCGATCTTTTGAATCGGGAATGACTTCGGAATGCGcGACTCCGTGCTCTTAAGTGTCGAGCGG
AACTCGGACACTTGCTCGCGCAGTAGATCTACGACCTCAGCATACTCCAACTTCTGCA