Description :
From Genome Similarity Track
Location :
Scaffold_3600:295- 1404
Sequence
1109 bases(100 bases per row)
GGCACACGCGGATGGTGCACTGTGTTGAAGTAGAACGGCATCACACCTGTGGACGCGTGCATACTATTGTTGATGGTGAACTCTGCACATGGAAGCCAGC
GACTCCAGTCGCGAGGATGTTCAATAACAATGCCGCGAAGAATGTCCTCGACGACGCAGCTCACACGCTCTGTTTGTCCGTATGTCTCGGGATGATCGGC
CGTGCTCGCGGCCAGATCCGTACCGAGCAGAGTAAACAGTTCGCGTCAAAAGGTTGCGGTAAAGCGTGGATCCCAGCCGGCTACAATCGACTCGGGCAGT
CCAAGGTGTCCAAACACATGCTCTAGAAAGTGGCTCGCGGTCGCTTGAGCAGTCACATGCTTGCGTACCGGAGCGACATGCACCGTCTTGCTCAGTCTGT
CCACAAAGACGATTGCACAACTGTTTCTACCAGAATCTTCTAAGAAACCAAAGATGAAATCTATGCTCACCGACTTCCAGCGATCTTGCGGACTTGAGAG
CAAATACAATGGAGCTTTGTGCTTGTCAGCAGCTTTGACACGCTGGTACCGCTCACATGCGTGCACATAATTGGCGACCCACTTGTACTGATGGGGCCAA
CAAAATACGTCAGACACATAAAAAGGTCTTTTACCACAGCAACCTATCGTGATGGTTGAAGCGTACGAGCGTCGCCTCAAGCTTGGCTGGCAAGCAGTAA
GCGACAACCATCGTCCTTTTCATAGAGCGACAGAATCCCATCCTTCAGCTTTATCTGGACTCGACTGGTGCTCAAATGCATGAGATCAGGAGTCGTCTCG
TTACATGGAGGTTCTGGGCATGCTCAAACACTCTCTTCGTAATCAGGACGGCGCGACAGCGCGTCCGCGAGCACATTCTCTTTCCCTTGCTTGCATTCAA
CTCAAAAATTAAATCCTGAGAAGAAAGCAAACCTTTGCATCATGCGCTGCGATAGGTTGCAAGAGTTGATTGGTGTCCGTAAGGAAGCATGGTCGGTGTA
CACCGCGAATGGAGTCGCGCTCAGCAGGTGGAATCGGTACTTCAACAAAGCATACTTGATCGAAAGCAGCTCGCTGTCATGAATGGGATAGTTCTTCTCA
GCGTCTTCA