Description :
From Genome Similarity Track
Location :
Scaffold_18:294954- 296191
Transcript NameFunction/comments
Phyca_LT1534506188PREDICTED: ran-binding protein 9-like

Sequence
1237 bases(100 bases per row)
ctctgtgcaagcccttaactcaatccgatcggatcaagttaaggacttgcacagaaaccctcgatatcaaagaggaaaggagccgcgccggcattaatca
cggcttcgtcaccaaaggcgtggagcgacacagcagcagcgtagtcacctggcaacacctcagtaggagctgctccgaccatctcaccgttaagggtgaa
gaagacctggtgcttgtcagcgtccagaccacagccaaccgtgaacgtcggagcatcctcctcctggtttccgggctgagccacagctcggccccacgat
ggaccgaaagcgctccactcaccaccgtacggcttggcgccatcgttgaacacgaagtcgccgtcgttgccgtggtaggcgtaggacacgcccttccagc
ccacgtgctctccagagccgaagccgtaagcgtttcgggtcgccgcgtcggagacggacgcgagacccacgcttccgcagcctttaaggcccacctcgta
gtatgatatgttcttatggagggcgcgagcacaggaaagcacaggaagtttcttggcgccgcggagtgagtccactgcacccttgtcgaagttgcgaagc
atggaattgtttacgacacggtacttgccgttgggcaggcggttcacgctgctgcgagtcgacagctcataatccgtgtctgatagacgcgcagcgcaca
gcgtcagctggtcggtatacggcaacgtcacgtacgtttccggcagcattttagcgcgccattggcggctgtatagacccgtgaacagcatctctgagga
ggtgatgacgtcgtggaaggccgtacaaacctgggcggcacattgcagctcctccatcgaaaggaactcgaagcagagctcgagggccgccagctccagg
gcctcaccgtcgcgtgtgtggcgacgcttgagacgcagcgtggtcagtagatcagcaatttcagccgtgttctgtgtgcgctgaaggtcactccagcgga
tgttggctggctgattgttgcgcttggcgacagcagcgtacgactcgtacacgacacagcagtcctctggttcgagatccgaggtgtccgactcgtcatc
actggtgttactggacgtggagcaggagctggtgatgctgccgcggcgacgtgacagacggcggacggacgacttcttggtaagcaccacgaacgagttc
aggtgctgcaggcggggcgacgtggtcggcacggtcg