Description :
From Genome Similarity Track
Location :
contig_83:29491- 31930
Transcript NameFunction/comments
g12779.t1hypothetical protein

Sequence
2439 bases(100 bases per row)
TGCACTCGTCCATGGCGAAGCGTTTCAGGATGTCGTCCACGTAGCGACGCTGGCACATGGTCACCGCTGCCGTCCGGCCGTCCACCAGCTCGATCCCAAG
AACAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGT
CGTCCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCTTGATGTAAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGA
ACTCGTCGAAGGTCTCGTTCCACACGCGCGAAGTTTGCTTGAGACCGTAATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCT
TCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGCCGAAGTACTTGGCGATCG
CGATGATCATGCGCAGCGTCAAGTACTTGACCACGGGCGAGAACGTCTCCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGC
CTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAAC
ACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTGCGCCAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCG
ATAGATCGGCTGCTGCTTCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGATCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGT
CGGGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCCCGGTGGCGAACGAGGCGCGATCTTCTGGCAGTGTCGTCGTC
GCCACTCGGTCGGCTCTTGCGCTTCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGCCGTCCAGGTCGAGCGCGTCCAGGTCCAGCGCAGCAT
CATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATA
AAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTAC
GTCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGT
TCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGAT
GGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCG
AACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACT
TGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCA
GATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACAC
ACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCG
CGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCAC
TTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTG
CTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGG
CCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCT
GTCGACCGCCCACATGCCGAGCATATCCTTGCCCGTCGA