Description :
From Genome Similarity Track
Location :
Scaffold_26:294903- 296498
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009463Similar to Cry1: Cryptochrome-1 (Rattus norvegicus)

Sequence
1595 bases(100 bases per row)
CTGACGCCGTCGACGCACTTCTTGGACGCTGTCGTGTGGTCCACGATGGGGAACGGGTAGTCCTTGCCGATGAGACACTCGGCCGTGCGCTGCACGCCCA
GCGGCGCCTTCCAGGGCTCGAAAATGTACCGCGCGGGCATCTTGCGAAGCGCTGGGATGTACTTCTTGATGAACTTGCCTTGCGGATCCCACTGCTGGAT
GAACATCGACGGCGAGTGCACGGCGTTGTAATCCGCGAAGAAGCAGCTCGAGCTCACCCAGAGCCAATTACCGATGTTCAACGCCCAGTCCAGGTCGATG
AGCTTCTCCTGGAAAAAGTACGCGCCGCGCAGCCACGAAATGTACAGATCGCCGCGCGTGAGGAAGCACGCGACCGCGTGTCTTGCGACGTGATGCGCCC
ACCCTTCCTGCTCGATCTGCCGCATCACGGCGTCGATCCACGGGTACCCCGTGCGGCCAGTCATCCAGCTCTGCAGCTGCTCCATCGCGACCTTGGTCTC
GTCGTTCAAGACGGTGTCTGGGGACGGCACCTGCTGCAGCTTCCAGTTGATCTGCTTGCACAGCGGGTTGTGCTCCTGCGTGTCGAAATGCGGCACACCC
ACGGCGTAGCAGTAGAAGAACTCGCGCCACATCAGCTGGCCGTCCAGTGTCACGGGCGGAGGACCCTGGAGTCCGGGAAACTTGAGCTGAATGAACATGA
CCCGGTAGAAGAACTCGCGCGGACTCATGCACCCAAATGAGACGTACGCGCTCAACGCTGTCGTCGACGGCTTCTCTATACACGCAGGCGAGGTCTTGGG
CTTTTGGAAGAGCCCCACGCGCTCCTCGTTCGCGCAAAACTCGTCCAGCATCTTCAGCGCGATGCTCTCGCCACCATACAGAAACGAATGCACCGCTGGA
GCACTGTGACCAAACGCCGCGAGATCTGGGATCGCGAACGGTTCGCTTCTGGGGCCTGCGACCACAGCGCCGCTGAACGCCAAATACGTGCGACAATACG
TGTCCAGTGCGCTATACAATTGGTCTTTCGAGAACTTCCATCCGGGCACACTTGTGGGCATCGGCGTCGGCAGACTCGGCTGCGGCAGCGCCTCTGTGAG
TTTCAAGAACTGCGAGAACTCGGTCGGCACGACGCCGCCGTTGAGCGCGATCACGGCGCGCGGGTCAAAGAGCGTCTGCCCGTGGAACGAGCGCACGTAC
ACATTGAAATGGCTCGCGATCGCGCGCACGTCGTTGTCCTGCGCGAGTGCGTACGGTACCACAGACTCCTCGAAGAGCAGATCCGTGATGCCCCAGGCCG
AAAACACGACTTTGAACACCTCGGACGCCTCACCACGCAGCACGACGAGCGCTGAATTCCGAGACTCGAGGTTCTGCGATAGATCGGCCACGCACTCGAG
CAGGAACTGGAACCGCACGGCGCTGCAGCGCTTCTTGACCGGCCGGTGGATGATGTAGATCGGGATGAGTTCGTCGAGTTCGTGGTGCTTGAGCGCCTGC
ATGGCCGCGTGCAGCGGCTTGTTGTCGTGCAGCCGCAGATCGCGACGGAACCACACGAGCGCGCGCCGTCGGGGCATCGGCGCCGCGACGCGTTC