Description :
From Genome Similarity Track
Location :
contig_83:29488- 31928
Transcript NameFunction/comments
g12249.t1hypothetical protein

Sequence
2440 bases(100 bases per row)
GCCTTGCACTCGTCCATGGCGAAGCGTTTCAGGATGTCGTCCACGTAGCGACGCTGGCACATGGTCACCGCTGCCGTCCGGCCGTCCACCAGCTCGATCC
CAAGAACAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGC
ACGTCGTCCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCTTGATGTAAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCAC
ATGAACTCGTCGAAGGTCTCGTTCCACACGCGCGAAGTTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGA
CGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGCCGAAGTACTTGGC
GATCGCGATGATCATGCGCAGCGTCAAGTACTTGACCACGGGCGAGAACGTCTCCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGG
CGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTC
GAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTGCGCCAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGG
CTCCGATAGATCGGCTGCTGCTTCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGATCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTC
TTCGTCGGGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCCCGGTGGCGAACGAGGCGCGATCTTCTGGCAGTGTCG
TCGTCGCCACTCGGTCGGCTCTTGCGCTTCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGCCGTCCAGGTCGAGCGCGTCCAGGTCCAGCGC
AGCATCATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATG
TCATAAAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGA
TGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAG
GCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTC
CGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGG
TCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTC
CGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGG
CCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGC
GACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCAT
ACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCC
ACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGAT
TCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCAT
GATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCG
CCGCTGTCGACCGCCCACATGCCGAGCATATCCTTGCCCG