Description :
From Genome Similarity Track
Location :
Scaffold_50:294860- 297230
Transcript NameFunction/comments
Phyca_LT153410499chitin-binding protein, putative

Sequence
2370 bases(100 bases per row)
tcgaactctaccccgtcgtcgaattcgactccttcgtccaactcgactccatcgacgaatggttcaccttcgactacgacagccccgagttccttcaatt
ctgactcgtccgttgctggtgaggcggagacgagcaagtgcgctcgccgtatgcgtcgtcactagtttcgcctttgacgtaagttttgaatgttgtgctg
tataaatctggtggcaagaataccccttaaaccaacaacatagttgtcattagcgtacgtacatatcaagtttgagtagtacagacaacgatgtgatctc
ttactctacgaaacttagtgcgctggatatgagaggcctactacagataaccatgcgtttctctctctctctcttgctggtggtctggtatctcgtgacg
agattctcgtcgccgacgagtcgtcggtatccgcaaggtcaagctgaagtgcacgcacacgcatccgacgaacgacagcattgttacgtgtgactcgcgc
tagccaccttggagcatccaccagaaggtaaagcgcccgtcaggttgagcctctcagtagaactaagtcagtacaacattacagatcccaagaaacacct
gacagactcgggactcataaagataacaagtgtgatgaattgcacacatttaaactctaacaaaaaaacaacaaatcgctctctagaatcctgaaacctg
tgctttatatttcttaattgtattttgagatcattagaaaccaaaggtttcgtccggctcagctcgcttaacgccaggttcctgttcacaatctgccgga
ctccattgtcggatgtcctcttcatggttccgtcgcgcttttccgtctttcggatctaccgagtaacgtctcgacctgaaggtcctcgctcagaaactat
cgctctcctatcattttcactttggcgtgctacagctatctaaacccgaacagtaaaacgaccccatgcaacctactggaatcgtctcgcttgccttggt
agccaccgctgccgcattgttcacggccgccgatgcccacggtcagatgctggtgcccgactatcgtcaaatctccgccaaattccgcaaggattcaggc
gccctctctcaggctggcgaccaggagctgcagtacgcgcctgtcgagaatctgtcaggtcgttcgcaaaaggatttcccagaggctgcgacgttcaacc
tcatgaacggatgtcgaggcactgtgtacgaggaaggcaacaatgtcaccacgttgaaagctggtgctgactttgatgtcaagtggatcatccaggcacc
ccaccccggcacgatgaagctgagcattgtcaagccgagcaaggactctgccggtaaaatcacgtacgagaactacaagtcaattctaaccgtcgacccg
ttcgccaacaacggcgggaaggcagcactaccgcgacgatgcccacggatgtgaccgggtgcgacagtgccggtgactgcgctctgcagttctactggca
ctcggacatcgccaaccagacctaccctacctgtgcggatatcattgtgtcgggtggtagtggcggcacctcaactaccggtactaccgctgctccgacg
gctgcgtcttcggagacttcagctgctggaagcgaggaatccacggtcggctccgctgatggtagcaatgctcagactacgccgtcgacagaggaatcga
ccgacggtagcactgcacagactacgccttcgtccaacacgaccccgtcgacgaacacgaccccgacggcgaccactgcggccccacaggtcaccactgc
gccatctaccgctacgactgcacctagcacctcgactaccgattcatccgtcgctggcgactcggacactaacaagtgttcacgccgcatgcgccgccaa
tagatttacatgtagcagtcgactcgtagtggacgaagaagtctatcgttttaagtttttaaatgttctgtcgcgtgcggttgatggtaaatttaccgta
aacgtcaatgccatcagtgtcgtttgttcctcctcttgtattaataaagctgccgatctttaggttttcaagtctcctgacagcctgtcagtgacaggag
aaccagcctggttaccaggcgcatgttcttgcacttttgagggtggcatccagtcttgcgcgatactacagtactgtatcgcgtccaggtggtttgcgag
aacttgggtgaggtgggatcagatgaacgtcgcgaacagcgaagcgaccaccaaggtgcgttaatcaatttcaatttggacaccaccagcatcagcctcc
gtcgatatcactgattaattttcgtaacctttttaatgaactgtgttggccacatttggtacggaggaga