Description :
From Genome Similarity Track
Location :
scaffold_22:29475- 33255
Transcript NameFunction/comments
Pl_112016conserved hypothetical protein

Sequence
3780 bases(100 bases per row)
GGATCTTGTTCAATAAGCTCGGTATCGCCAAGTCCGTAGATCCGTTGAGTGACATCACCACTGCATTATCGTTGTAGCAAAGCCACACGACATCCATGAA
GCTGCTTACGGACTGACTCTCGCTCAAGATGCGGCACACAACGTCTACAAATTGGTCCGATCTTTTTACCCATGGCGACGGAATGTACTCGAGTGAGCTG
GACACACGGCTGTATGAAACATCAGCCTGTGATTTGCGGTTCGGCCGGGATGCTGGAGGAATGATGAACACACACGCCAATTGAGCGGAGTTGGGTGACA
TGGCTAGCCCAAACACTGGGTATTTACCAGCGTTAGATGCAGCAATAGCTGTGCTATCCGAGTTGCCATCAGCTGAATGGGTATGAGTCGCATCGCTCGA
GTACAACATTTTTCCTGTGGCTTTCTCCCAAACTTTGATCGTGCCGTCCACAGCAGCCGAGAAGACTGTGTCTCCAAAATAATTCATGTCGATCCCAGTC
ACATTTCCATCGTGTGCCTTCCACTTGGCATTCGGCTGTGCTTGTTTCTTCTTCTTCAGGTTCCACACCGAGATCGTTGATCCTGATGCAACAACTAAAT
CATTGGTTGGGCTGTTCGAATACGTCCAACGATTCCCCATGCAAATACCAAAAACCGGCTGAGAATGCGGCGCCACTATAACGCGATCAACAGTGATCTC
TTGGGGCGATTCATCTAGCGCAGTTGCCTTCACAGGAACACTAGCAATGAGAACATTGCCCTCCGACGTTCCCAATGCCAAGCCAAGGTCCTCCCTCGTT
GTGTAGGTCGTCCCATGTCGGTGCAACTGCTGCCACGTACTAGTTGATACCCATCCATATCTCTCGGTATCAATCCACGCAACTGGGGAAGACGAGAGAA
AAGGTTCGAGTTGCTGTCCCGCTACAAAAGAAGGGTACGCGTACGCCCAAATGGTGCTCACTTTACGTCCGGACAGTGCAATCAGCGACGTCGTGCTTTG
CTTATCTGCCGTCACCATGAACGGTGACCAGGCCATCGTTAACGTCGACATCATGGCGCTTCTGTGCGTATACTCGGCAACAGAATTCAAAGCGAGTTGT
CCCTCGGTCGGATCCAGCTTCCTCTTCTTGTTCTTCTTGTAGTATTTATCCCCACGAGGTGCAGCCATCGCAGCACTTGGTGGTGGCTGATTAAATCGTT
CATCATGTGACGGTCCCAACCAGAAGTTCTTGCTTTCAAAGAACTTGAATAAATTCTCAGAAAACACTGCAACTTCCTTCCAGTTCATGTGAAAGCTTGG
TGGGAAGTGCAGACTCAGTCTGAACGATGCTGTGAGTGCTAATAAAGCACAAGAATTACTCGGTGCAGAACCTCGCGGTCCCCACACTGCAGCGACAAAT
GCTGCACCTGTATTCTTGGATAAAGACAGCTCTTTCGGGTTATGTTGATGGCGGTTGCTATCATTGAGCAAGAAGTACGTGGTGCTGGTCTGCGGTAGTC
CAGCGTCAAGTGACTGAAGAACTGGAGGAATTTCCATTGGAATGTGCTCATTTACAGTGCGTTCCGGCAGGAAAACAAAGTCTTTGGACACTGCGGGACC
TTCAGGTTGGAACATCTCGAGCTCGCGACTGCGGAACGTAGCGACAAGCACACTTGAGTCGGATACGACAGCGAGACGACCATCTTCGGACCATACGACA
CCCCCTGGGACTAATGGACTGCCTGGGATACGCTCGCGAGACTCGACATCTATCGGCAAAAGCGCCACATCCGACACTTGATCGGTGGTCATCATGGAGA
CGTTAGAAAACTGAGACGTGTGACGAAATTGGTGTGTGCTGTACATGAATTTGAAAGATGGATGTTCGATGTGGACACTGGAGGACGGAAACTCTATCTC
TATTATTCTAGTTGGTTAAATATGTCGTCTTGGGAGTTGGAAACATGGTGTTCTTCATCACCTTCGTATTCGCTGTCACTATCGCTAACGAATTTGGCTG
AGTCGGCTTCGGAGACTTTCGACTCGATTTCGCTGTCGCTGCTGTCTTCTGAGGACGAACTCACTTCGTGGACAACAGGACCTTCAGAGGTATCCTCAAC
TGTCGCTACTATCACTATCGCTTTCACTTTCCGTAACGCTAACAGTGTCTTCAGTACCACCACCTTGAAAACCTTTCACCTTGTCTTCGTCTTCATCATC
GCTGTCACTATCGCTTTCACTTCCGGTAGCACTAACAGTGTCATCCATACCACCTTGAAAGCTTTTCATCTTGTCTTCGTCTTCATCATCGCTTTCACTT
TCACTGTCGCCAATTTGAGAGGGATCCGACTCTGACTCAGAGTCGCTTTCGCTGTCTTCGGGTTTCATTTTGTCGGTGTCGCTAGCGACCTCAGACATTA
CAGTAATATCACTGTCGCTGTCACTGTCGCTCCCGACATCCATGACGTTATGCTCGCTGGGTGTTTCACCTTCGTCAGATTCAGAGTTCACCAGTTCGAT
ATCTTCACCACTGTCGTTGTCGAAAACCTTCCTCTCTTTGGCAGGTTCAAAGTCATTATTATTGTCGGGTGCTTGCATCTCGACATCGTCATCCTTCTTG
AAACTCTTCTCACTGCTGTCAGTTTTATCTTGGACGGACAAACCTTCGTCCGAGTCGTCGCTTATCTCGATACACATCTCTTCCATTTCCTGGTCACGTT
TCGTGTCGATCAGGATGAATTCTGGCTCGACGTCCACCTTGTCACCAAGACTGAATGGATGAAGGAACCGGGATTCTTCCCGGTCAGTTGATGTCTGCAA
TTTGCACCAACAGCCACAAAATAAGTCACAGTTCCAGTCAACCAAATTTCATTTTGTCACGTACCAGCCAATTCCTGCCCCGTTCAATTGACGGACAACC
GTCATGAAATCCGCGACTCGAGGTTGGGAACATCATCGCTGAGTTGAAATGCTCCATTGCAATATGATATTGTCGTTGCATCTCTTTCCATCCATTCCTC
TTCACCAGCTTGTACCCAGCTTCGAACAACTTAAATGGGGTTTCATAACAGTGTCGATTGTGGTCCCACAATCTTGCATGCAAGGTCTTGGCCTCTTCAT
CCAGCTCTTTCATCGATTTCCACGGGGTTGGAGGGCGACTGGGGACCATATACTGTTGTCCAGCATACACCGTAGCCGGTGGAAAGGCCAGTTTACCTCG
CTGCTGATGGAATATGTCTTCTACAACGCGATTGGATCTGGGGTCGAGACCTCCGTGCACATCCAACTGGTGCTCGTACATGTCCGTGAATGAATCGAAT
TTGATGCAGCAGTTGGTATCTTTGCAGATATATGGCTGCAACGTGGAGCTCCAGCGGTAGAGATAGTTGCAGGACTTGCAATTACAGCGGAGGTTAAAGT
TCTTGCTGACGTGGAATTCTTCGTCCATGTCCACGAGATCCTCTGTGATCGTAGTGACTGGAAGTCCAGTGGACGAGCGCAGACGCTGTAGTTTCTTTAA
TCGGCTGTTCTCGTTGGGCTTGCGTCCCTCAAGCGCCATGTTCCTGTAAAACCATCGTTTGAAATCAGCCCTGACCTTCTGCCGCCGGAATTCGCGCATC
TTGAGGCGCAAGAGCGGGATGGGTGAGCTGATGGGGATGTCCATGGGGCCTACGATACCTGCTGCAAGGTCCGAAGCGCTTGGCGGGGGAGCATTGGACG
TGCGCGGCGCTCGCGTGGCTCGCGGCATGATCACCAGCAGTTCTATTGGCTTCTGCGACGTGTGACGGTTTTGGCGCCAT