Description :
From Genome Similarity Track
Location :
Scaffold_613:2947- 11950
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_613-abinit-gene-0.14TRNA wybutosine-synthesizing protein
Pytiw_DAOMBR242034maker-piw_contig_613-fgenesh-gene-0.0Poly(A) polymerase
Pytiw_DAOMBR242034maker-piw_contig_613-fgenesh-gene-0.3Anaphase-promoting complex subunit

Sequence
9003 bases(100 bases per row)
GTGCGGATCGCGCACATGATCTTCTTGTTGCCCAGCACGACGCCCGACTCGCGGAAGCCGCACGCAATACCCCACTGCAGGAGCTCCTTGGCGGACTCCA
AATCGCGGCACACGACATGCATGATGAACGGCTCGTGCTTGATGATCAGCTGAATCGTGACAAGAGCGAGACGAGAGACACATCAGCCACTGCGCAACCC
ATACAAAAGGCAATAAGGCAGACGCACCATGTTGCTCTTGGTCGAGACGGCGTCCGGCGAGCGCAATGCGCCCGAGAGCTGCTCCATCGTGATGGTCGCG
TGCTCCGCGAGCAGCCACTTGCCGCCCTTCGTGATCAGGTTCACTGCCTCCTCGCGCACACCATTGGCTCCAGCATCGCTACCATTAGCAGCAGCAGGCA
CGCCACAGAAGACAGCAATGCGCCCCGAGCACGAGCTGCTGGTCACCTGTCGAATCGCCACCAATGAGTCAGTCCACTACGAGGAGCTACGAGGAGCTAC
ACACGCACGTACGTAATTCGGGTGGTCGTTGATGAGCCGGATGAGGTCGACGATGGGCTCGTCGATGCTGCCCTTGGGGCTCTTGTCCTCCGCCATGCGC
AGCTTCCGCAGGCTCTCGCGCTTGAAATGCGCGAACATGCGCACACTCGTCCACTGTTGCTGCTGATGGCCGCCTAACTGAATCAATAGTGTCGTCTCGC
CAGTCAAAAAAGGCCAGAGAGCAAAATCTGCGACGTGTGTGGAATTGCAATTGTACCTCCCCTCAAAGGGAGGCATAAATACTGTCGTGACAGTACACTC
TATACTGCAGGTAAACTACTTCTTTTTTTTTCCGAAACGATAGAAAGAAACCTCATGTCCGATACAAAAACCAAGCTTGTTCCTTTTCCATCGTTCTCTC
GAAAAAAAATGCCATTGAATTTGTTACGGTATAAATTACCCATACAACAACAATAGCAGTGCTACCAAATAAATTACCCACACAACAACATTAGAGAAAA
AAGCGCGCCAATCGTAAATTCGTCACATCGATCGACTGGTTCAGTCCAAAACAAGACGAGCCAACGCGACTGCTCGCTCGATCCGCGTGAAGCAAGCAAG
CGCCCACAAGAGAGCCACCACACCATCGCTTAGTAGAGTGAGTGAGAGCTATGCAGAGCGTGCCACTACCGGTCGCGGCGCACGTGCTGGAGCAGGCGTA
CAAGGCCATCCGCACGACGCCGCCCGAGCCCAAGGACCTCGAGCAGTCGGCCAAGCTGCAGGCGTTCATGGACGCGCACTTCCCCACCGAGTGCGACGAC
AACATCACGCGCCGCTCGATGATCCTCGCCGAGCTGCGCTCCATCTTCCGCGAGTGGGTCAAGCAGGTACGCTTCCATATATAGATATAACACACACACA
CTGGAGTGGATAGAGCGCTAATTAACAATGTTTGTGTGTTTGTATAGGTCTGCGTGCAGAAGGGAGTGCCGGAGGAGATCGCCGCGGACGCCGGCGGACA
GATCCTCGTGTCGGGCTCGTACCGCCTGGGCGTGAACGAGCCGGGCGCGGACATCGACACGATCTGCGTGGCGCCGCGCCACATCTCGCGCGACGACTTC
TTCTCGTCGCTCAAGGAGATCTTCCTCAAGCATCCGAAGGTGTCGAACCTCGTGTCCATCGAAGGCGCGATCGTGCCGATCATCACGTTTGACTACGAGG
AGATCAACATCGACCTCCAGATCGCCATCCTGCCGCGCAACACGATCCCGGACGACCTCAACATCCTCGAAGACGCCGTGCTCATCGGCGTCGACACTGC
CACGGAGAAGTCGCTCAACGGCCCGCGCGTCACGGAGCTCATGATTAAGGTACGCACGGCATTGTGATGGTATAACCTAGGCTGCTGTTTATAGACTCGT
TGGACTAAGCTCTGGTTGATATCTGAACAGCTGACGCCGAATCGCGAGAGCTTCATCAGTGTGCTGCGCATTGTGCGTCGCTGGGCCAAGCGCCGCGGGC
TCTACTCGAACAAGATGGGGTACCTGGGTGGTGTCAACTGGTGCATTTTGGTGTGCTTCGTCAGCCAGCTGTACCCGACGGCGGCGCCCTCGACGCTGCT
GCTGCGCTTCTTCATGGTGCTCGCGAACTGGAAGTGGCCTCTGGCAATTCAGGTATGCTGCTGGTATGTGAGATGGGTTTGAGAGTGCTGAGTGGATTGC
TAACTTTGTGATTGTGTGTTTGTGATTCTCTGTGCAGCTTTGCAAAACGCATGACGCTAAGCTCGGCTTGGAGATCTGGAACGCGAACTCTGGCAACAAC
AGGTACACCAATCAGCAGTGCTGCATAGTGCGTGTGTTGTATGGACGCAGTGACTAATACTTGTGTGTGTGAACAGATACCAGGTGATGCCGATCCTGAC
GCCGGCGTACCCGTCGATGAACTCGTCCTTCAACGTGTCGACGCACACACTTGCGGTGATGAAGGACGAGCTGAAGCGGGCGCTCGGCATAGTGCAAGAT
ATTTTAAATAAAGGAGGCGCGGACTGGAGTCCGCTGTTTGACCCGTCGGACTTTTTTGCAGTACATCAACACTACCTCGCGGTGGACGTGTACACGGAGA
CCGAGGACGAAGAGCAAGCGTGGTGCGGCTTCTGCGAGTCGCGCATCCGCAAGCTGGTCGAGAGCCTCGCGTACATCCCGCAGCTGTGCCGCATCCGGAC
GTTCACGAAGAAGTACCCGCTGAGCTTCGTCGAAACCCAGGCCTCCGGTCCAAGCAATGGTGCCCAAGACGTTGCTGCTGCTGCCAAGCCGAACAAGTTC
GGCGTGTGCTTCTTCGTGGGCTTTGACATTGACCGTCGCCAGCTGCGCGGCCGCGAGGTGAGCATCGACAACTCGGTCGACTACTTCAAGCACAACGACC
TCTACCGCTGGAACAAGCGCACGGCAACGATGGACGTGAAGATCACGCCCGTGGTCTGGAAGAACCTGCCTGAGTGTGTCTTTGAAGACCTGGGTGGCCG
CCAAGTGGCGCGCAGCGTCCGTCGCGAGTTCATGAAGAAGAAGAAGGACGAGGAAAAGGCTGCCGAGGACGCTGCGAATGGGGTCGTGGCCGGCACTTCG
TCCGGCGAAGACACGGCGGCGGCGAAAGACACCCAGTCCCAGGACACAGACGGAGGCGGTACGTGCGAAGAAGACAACCTTAGCGCCACGGAAGACGTGA
ATCCGGCAGCGGCGGACGACGAGAGCGAGTCTGCTGCTGAGAAGGCTGTGAACGGGAATGCGAGTGCCAGTCCACCTCCTCCTCCGCTTCCCCTCGGAAG
CCCCGGTCCGAACCCTGCAGCGGAAGGGAGCAGCGCGTCGTCGTCACCTGTGAAACCACCTCAACAACAAATCGAGAAACTGGATTTGTCTACTCCTGTG
AAACCACCCAGAGCCTCTGCAAGCGAGGCTGTTGCTCCAGGCAAGCGCGATCGCGAGGACTCGTCGTCTGCGGCTGGTACTCCGCTCGCGAAGAAAACGT
TGGCGTCGGCACCTGGCACGCCCTCCACGACCACGTCGACGCCTTCCAAGCCACTACCGCCAGCTCCGCAACGCACGACGACGACGGTCCCAGCGCCTCC
GGCCGCCATCTCCTCGCCGCGCAAGAGACGTAAAATGAAAATCACCTTTGCCAAACTGAACTGAGTTGCTCTCTCTCGCTTCCCAAAAAGAAAAAAAAAC
ATGAACTGGGACAGCAAAAAAAAAAATGAAGAGAGAGGAGAAAAAAAAACAAAAGAGAGAGAGAAGGATAGCTCCACACAACAAAAGAAAATATTTAGCA
GCGCAACAAGCGCATAGCAAGCAGGCAGGCTGGGAGATGCCTCACTCGCACAACACAAGACAGCGGCTCGAGATCAGCACTTCTGCGAGGTGTCTGGGGG
TCTGAGGAAAGAGAAGCCGAGCTGATGAGCTACAGAAACGTGAAAAAAATCGCGACAGCACGCACCGAGTTCGAGCCACCTCGCCTTGAGCTCTTCATTT
AAAAAAAAAAGTTAAGCGCCAAATAAAAAGAACGACACGAGCTGTAACCACAGTGCCTTTTCGTCTTCATGCGCCACGCCCGTGGTCTCCTCCTGCTTGT
GCTGCTGCTGTGAAGAGAACAGGAATTCGTCGAGCTGGATCTGCTGTTGCTGGGCGAATGTCGACTTCCACGCTTCTGGAGGTGACGTTGCCATCCGACT
CGACGGTGCTGCAAAGTACGTCACGAGAGCGCTCAGCACGACACGCGCACGCTGGGTTACCTCTTCAGTGTCACCAGGAGCTCTTGTCTGGAAAATCTGG
GCATGGACATCGGACATTGTCGTGAGCTGGGAAGTCGAGCAACTTCCCCACAGAACTCGGAGCGCCGCCTCCGTCTTGTGCTTGAGCCCGACGCAAAAGT
CTCGATCAGCCAGCGAACTCGACGATCTTGTACGAATGTTTCCGTCGCAGTAGTCCATGTAGAGCTTGAGGTTGCGCAGTCCTGTCATAGACGACGGCTG
GAAGCCCAGGTGCTGCAGTCGGAAGAGCGCGTGAAGAGCATTCAGGTACATTGGCAGGAAACTCGAGGCCTCTTCAAGCACGTGTCGCGTCACCAGATGT
CGACACTGGATTCGCCACCAGCTCGCAAAGGAATCCGTGGCTGCATTTTCATCACCAAGTTGAAAATGCTGATGTTGTTGTCTATCAGCCGCCGACAGGA
AGTACGAGTCGAAGATCTGGACAAGCTGGTCATCCTTGTCGTGAACGAGCCGATGATCTGGCGTGGAGTGGCTCAGCAATGCGCGTAGCTCGCTTGAGAG
ACTCGCAAGCCCCTCACCGTGCTCACTGCGCTTGGTCCTCTTGAGCAGAATCATGTTTCGACAACGGAGAAGCTCGAGTCTGAGCGCGTTCGCAGTCACC
ACGGCGCTCTGCTGGGTCTTTTCAGCCTTCAGTTTCTTCTTCTTCGAGGCCATGAGGATCTCCACGGGGTAGTATTCGCTGCTGGAGATCAGGATCCGCT
TGATCGAGCTCAGGTCTGGCAGCAGACACGGCGACTGGAGCGTCAGCCACTTGCTGGTCGGCTTAAGAGTCTCTTCACCGCTTCCCTGCAAAAGGTTACG
CTGCTGATGGAGCTCGAGGCGCACGGGAACGGAGCAATTCGAGCCCGAGTTCACGTCAATCGTCTCCAAGAGTCTCGACGGGTCCACTGCCAGCACGTAC
AGGTGTCGGAATGCCTGCAAGTGGTACTTGTTGTCCGCAGTGTTCATCGGATACATCGGGAAGAGCGCGATGACAAGCGCCGCAATCGCGTCCTTGGAGC
GAGATACCGTCGCTCGCCCACCGCCGATGAACAGCAATCCGATCGCAGTGCTCAACGCCATGTGGTTCCCATACGTCAGCTCCGAGTCCACGCGCTGGCG
TAGGTTAATTGATCGCAACAGTGTCAGTGTTTCAATGTTGCCCGTGCCAGCGTCCACCAGAGCGAGTGCCTGAGCGCACACAGCGAGGCAGCGCTCGATC
GTCACGCGCTCGATGTTGCCACCACGCCCGCTCATGATCCCCGATGACGACGCGGTTTTCGATCGCAGGCCGCGACAAAGGACAACGTACTTCTTTAGCG
TCGCCCGAGCGCGATTATCGCCTGTGCCTGCGAACCGGAAGCCGATACTGAAGCACGCGCCAGCGATCACGTTCGCATAGGCCTCGCAAATCGACTGGGC
GTCCGAGTGCACCGACGAAGTTGAAGATGCCGAGTTAGACGCCATGTCACGATCTCGATCGGCCGCTTGAGGCTCGCCTTGAAGAGCTTTGTACGCATTT
GCGAGCTGCATCGGGACTTGGGTGTCTTCAATCCACTCGGTTGTTGGGATAACCAAGTCCCACAGCACCAGGTTCTTCGCCAGAGTACGCACCAGCAGCA
GATCTGGACGCACTTGATCAAGCAGGATGAGCGTGTCGGGGACCGCCAGTTGGGCCGCGATCGCCTTGTTCTCGGTCTGCATGTACATGAACGCGAGCGC
CAGTGCGCTGCCACACGCCGTGACACCAACATTGACGTGCTCACCTCGCCACGCGCGGTCATGGGGGCTCTTGGCCTCGCGCGCCGAGCCTGCGCTGCCA
TTTGACGAGCCATTAACACTGTGTCCACCTGCACCACCAAAGTTGGTGCCTGTGCCAAAGGTGTCCCACTTGCGGCCGCGGTAGAGACAACCACCGGCGG
CATTCGCGTCGCCAAATTGCTGAGCCCCGCCGACAATGTACTTTTGAAGCTTCTCTTCGAGCTTCATGTCTGCAAGCCCCGGGTCGCCGCTCTTCGTCTG
GCCGCGGCCCAGCACTACGAGTCCGAGAGCGAGCCCGGCGGCCAGCGCGTAGCCTTCCAGCTGGTCGAAGGACGCGGTCGAGAGGCCCGAGTTGCTGTTG
CTGCTTACAAACTGCGCGGACGAAGGGGACCGAGCGATCTCCGTGAGCAGCAGCTCCGTCATGAGTCGATGGCCCGTAGCCTGATACAAAATCCCAAGCC
CTAGCAACGCTGCGGTCTGCGTCGATGCCGGCACGGAGAACTCAGCAAACGGTGGTGGGAGTAGCGACGGGATATGCAGACAGAGCATCTTGGAGACCGA
GCGCTCCAGCGTGAGCTCGAGTCCCGAGCCCACGAGCGGTGCCTTGGACGTTGACTCCGAGAGAAATCCGTCGTCTTCGAGCGAGATGTCGCCGAGGCCA
GCATCGCCGCCAGCTGATTCCGGAGAAGAAGACGAATGGGATGACGATGAGCCGACCGAGTCGCGACTTGAACCAGTCCTCTTCGGCTCTTTCGTCTGCG
TTTTCCGACGCTGTCGGCAGTGCGCAGCCGTGGTCGCCATCCCGAGAAGGATCGCAACGGTGACAAACTCATTCGAGAGCGATAGATAGTTGTATACGTC
AGCCATGGAGAGACATTTCAAATGCCCTCGCAGCCCCAGTCCAAGCAAGAGGCCAGCGTGGGCGGCGTAGGCTTCTTCCAAGCTTCGCTTCGTGGCTTCA
ACAGACTGCGGCGCTGTCGAGGCATTGCTGTTTCTACCCGCAGCTCGCGCCTGGTGCTCTGCTACTGACGGGCGATGGTACTTGATCCAGTAGCGATTCA
CCACGTTCGATAGGTCGCGAGCTGGCAGTCGAAGCCCCGCAGCACATCCATTGTGGAACTGTGGCCAGAATGTGAGCTCCTTGGCATAGCCCGAGACATC
CAGCGACACGATCGCATTTGTAGGCGGAGTCCTGCCGGCGAGTGGGAGTTCAGGGACGCGTAGCTGCCACGCCTGGTTCTGCGCCATGCTCATGTCAAAG
CTGCCCAATGTCACCATACCTCGAGCCACGGGTAGCGACATGGAGCGCTTACATAACAACAGGAGCCGAGCCTGCTGCTGCTGCACGTAGTCCTGGTCCG
TCGTGTCCGAGGACTTCTCGAGTTTCAGGCACAGCGGGCGGTTCGACCGAATCAGTCGCGCGACCTCTCTCATCCGCTGGTCAGACGGGAACAATGGTTG
GCTGAGCTGAATGGTCTCCTCGAGTCCGTCGCTCACATCGTGATGTTGCGGCTGATCGGCCTCGAGTTCTTTCATCCCGTGGTTCGCATGCTGACTCGAC
GCATGTTCGGAAGACTGGGGATCGTTGGTGCTCACGCGACTGGAAACCACGCCCGCGAGATCTTCTCGGCCGATGAAATGGCAAATATCCTCCGTGATGA
ACGGCGGCGGCGCGTGCCGGAACTTGCTGATCGCCTCAGTTATTGGAAACTGGACACCAAACGGCAGATCCTGGAGAGAGAGCCGCACGCCAAACGGATC
CTGGGTCAGGAACGCCATCAGCTCTGCTCTCTGCTGCCTTTCGAACTCTTCCTGCTCCTTGAGGGCCTCTATATCGAAAGTTTCTGGTGCTCCTCGAGGC
AAAGCCAGGAGCTCGTAGATTTGACAGACTGCGATGGTGCGCCACATTGGCGAGCTCAATTCTCCTGGCTCTTGCGTACCAGCAGCCGTCTCGATCGAGC
CATTCTCATTTGGAAAACTTGGGAATTGCTTTTGTGATGGTTGCGAGCGACCGGAGCTTTGAATTTTTGCGTGCACCCAGCCCAATATGTCTGGGACGCA
CTTGTTGTCCCACTCTGCGAACACATGTGTCTTCAGCACGGACGATGTGCTGGAGCTTAAACTCTTCTCGCCCCACTCTTGCTGATAGTAAGACGCGTAG
GCTTCGAGTCCGAGGAGCGCCGCCACTTCCAATTGTAAGCTTGCGAGCTGCTGGCGAAGCTGAGACGACATCACCGAGAGCTTCAGGTCCTCGTACAGCA
GGTGCAGCCCTGCAAAAATCTCCACCGCATGGGCTTGCAGTGGCAGAGTCGAAACCCGTTCGTTTGCCTCCTTGGACTTGAAAGTCGCTGACGATCTTGG
AGTCGCTGGCGCAACCGAAGAGCTTTTCATTTGGAGGAACAGCATTGCGTTCTCAGCCTTGTACGTATTGTGAAAGGTCGACCGACAGAGTTTGTCGAAG
GCTGACTCTGATTCCACTTCCAGCGCACCATCTCGTCCTGATCTGCTGTCCACTGAAGGATAGCTTTGGCTCGCCGGGCTGTTATTTGCGATGACGAGAT
CGCAAAACACCTCCCACTCAGTCTTCACACAAAAGCGACACGCTGTCTCCGTCTCCATGCTGGCTTGAGCGTTTTGTTGCTGGTACTGGGCAACAATGTT
GGCCTTCATCTCAAGGAAGACAGTCACAGGGAGAACGCCATTCTCGAGAACACTGAGCACTTTCTCTAACAATGGCGGGCCAATTGCAACCTGAAGCGGG
TGCTCACATCGGCTGATCAGCTCTGGGAAATCGGTCACGCTATGTCCGCAGATCTCAAAACCCGACGCGCCATCGAGCGCCCGGATCTCGGTGGTCGCTG
GCCAATTGGAGACCTGTAGGACACTCGATGGTGGCACGAGCTCGCAGATCGGATGCGCGCCTCGATGCAGCACAAGCTTTCGGTTTTGTTGGAAGACGAC
AAT