Description :
From Genome Similarity Track
Location :
Scaffold_637:2947- 11076
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_637-abinit-gene-0.1Sporangia induced dynein heavy chain
Pytap_DAOMBR444snap_masked-pag1_scaffold_637-abinit-gene-0.3Sporangia induced dynein heavy chain

Sequence
8129 bases(100 bases per row)
GATGAGGGCAACGCCAGCCAACACCCAACGTGCTGGGGGGgACTTGGTCTtGAGTTGTGCCGAGAAAACGTAGGTTGGACCGCGGAACTCAGTCTTGTAG
CATGGACACAAaTATGACCCCTTcGTATCGAGCTTGTCCGCCGCGACGGCTTTGCAGTTGATtACCGGCATCGAACAGAACATCTCTTTCGGGTGGGATT
TGTCCACTGTGTTGTTGGTGGAGTCCCACCGGCCACCCATGAGATACAGACCGTGGATATATGCTCCATCACGCGACGCAGCATCAATCTCCGTGTTGCG
GCGCTTGAGAACATCCGTCTGAATCACCAGCTTATCAAGCTCCCATTGGTTTTTCTGTGCGGTAACCTGCATGATAGCGGTTAAGAAAGACTGCGGGTTG
ATCATACcGCTGATCCACGTGACCTTGGGAATATCGATTGGGTTCTGTGTCCATTCCTCGAGCTGCTGAAGGCGTGATTCAAGGTTGGTCAGCCACGACC
CGAGAGGCcGCATTGATGGGAACGCCAGCTTCTCcCACGACTTTGGAACACGATCCAAGAAGAGCGATTCCTGAACGGCTTCCATCGCGTCCGACATCGT
GAGCTCACCAGCGAAACCGAGCTGCAaTTCGTTCAATGAACGCACGATTTCCGCTAACAGCACATTCATTGCCTCACACTCTTGTAAGAAcACGTTTTGG
TACGGGCCGACTTCTTCCAGACTACGGGCGATATCATCACACTCGAACTTCTTCTCACCAACACGACTcaTCACCATTTCAAGCGCTCCTTTAGCAATCT
CCGTtGGGCTCATACCAGCTTCACCCGAGCTTGCGTCACGTGGCTGTAGTTCCATCAATGTACGGAAGAGTGTCTCACTTTGTGTTGTTCGGAAATCAAT
TTCGGCGTTCGGATGGAGACCAAACGCGAGTGGAGAATCCGTCTTCAGCTCTGTGTCAATGTGCTCCAAGTACTTATCGTATGAAGAGGgCGGAATTGTC
ATGAACGATGGGCCcTTTTCATCACCAAcAAATGGGAAGAGTTCCATCTCATCAAGCAATTCATCACGCATGTAGAACTCGAGGTACGTATTCGCCAACA
GTCTGTCGAAGTCATTGACAATGTGACCCCCATACATGATTTCGCCGAAAATGTACCGAAGATCTGCCCATGGGATTTTGCCACCAGCaGAGTTTTCCAG
ATAATTCTGAAGACAAATCGCTGAGTCGCGCAAATCACCAAGAGAGAATGGATACATCATGTTGTACCCGAGTGGTCCGTACATTTTGCGCTCCATCAGC
ACCGCGTGGAAGTGGCAAAGGCCAAACAGAATCGATTTGACCTTGCCTTCTGCCTCTTCGATATACTCTTTCGGGAAACTCACAAAGGCACGCTTCAAGT
TCGCCTTGAGACCTGCTGGAGGCTCGTTTGTCAGCTTGATGCAACGATTCAGCACACCAATAGGGATGGAGTTGGATGGATCCGATGTCAAGAaCAAGCG
GAAGTTCTTGTGAGAtCCcTCCAGTGCAAACTCGTCGAGTTTTTtCtCGAGCGCTAACAGCCATCGTGGCATCAAATGAATGTTGTTCAGAATCACCCAG
TGACCATTACGATGAGCGACcTCCAGGCGATCCATGGCGAGAATGTCTTGTCCCTgACCCATACTCACATTGTGGTAGCTGACACCCCGCTCGTAACCGT
ACTTGACGCTCAGCTTGTCAACACCAGCGACGACATCAGCACCAGGAGaTAAAATGAAGTATAGCGGTGTCGTTGGTGTTGAATCCAAGTAGGACTGCTC
CATAaCTTGCAAaGAGTTAAGAGTGGAGTCACAGTCACAGTAGTTACTGCCGTTCGGAAGCACATGGCGAaCAAACTCGTTCAcaGCCACtGTCATACGA
TCTGGTCGGAGgCAACGGACGGCAAGAAGCTTCAaGAATGGAGTGCGATCCAGGCCTGCCCAATCAaGAGGCAGCTTCTCcGACTCGGGAGTGACGTGGT
tGTACCAGTCTCGAAAACGAGATGAAGCTTCCTTTAagTCTTGGGGCATTTTTtGGAACTCTTCGAGCGCTGCCAATGCATTGaTtGCATTCCATTGCGC
ATTGGGTAGCCAATCAATGGGgTTGGgCTCGGTATCAGCGCCTGCGGCCTTCTTTGGACCACGCAACAAGAACTGCATATAGTTCTCTTGCACCCTATTG
TCGTCGCCCAGAATACCACGACGCATCAAGTTGAATGTCAACTGCGACaGGAAAATGAGTTTGTGAGCTTCAAAGAGGCCTCGaGAAACCCATGTGTAAA
TCGTAATTCGCAACGACTCTCGCAAGTTTAGTACTCGCTCATTTTGTTTCTCTGCCTGTGGCGCTCTATCAATCGAGGCGTAGAAAAacGTGATGAATGA
ATCAAGCGAGTATCgaTACATGTGGTCGATCGCgCTTAGTGTCGTGAGGAGGAAATAAAGCATGGCACCTTCGGCAGCGACTGGGCGGTACAACTCACGG
GTGTTGTTGATCACGATCTCGGTTTCCTGATTCTTCTTCACAGATATCTGGATCTCAGTAGCTTTCTTCTTTGTTTCTTCAAGACTTTCGATAAGCGGTA
CATCACTCAAGATATCGTCTGGTGCGTTTGCCAGACGCTCAAGCAGTTGATCTTCTAGCTCCACCAAATCGATTTTGAACTTCTGGAATGCAAGGACTAG
CTCTTGTTTCTGTCTTTCTAGTTCTGGTTGTTCCTTCTTCACAACTTTTtCCAAGAGCTGATCCTCAAGGCCGCTTTCTGTCGCAATGAAGTTGATCAGA
GTGCATTGCGCTGCAATTTCTGGTTTGTAATGAGGGTTGCTGAGCTTTGTTTgaGGTACATGAAGAAGTTTGGGTCGTATTGGACTTCTTCACcACCAAG
CTTTAGGAACAGGTTCGAtCCTTTTTtGTAAACAGCACGTCCGAGCACAGGATCCAGCGTCGCATCAATTTCTTCACCGATATTCTCGATGATCACAACG
TGTCCGTTAACGATTGCGCTCTCCATTTTGCGAAGCCATTGGTTTTGACTCAGTTGCATGACGATAAGACCaCGGTCCTTCTCTTTTTCACGAAGCCACT
TAATTCCCTGTAaCTGTGGGTCGATCACCAACGGCCAACGCTTACAGCTTGTGATGATGGCACCATTCTCGATCGAAATTCGATCTGCTGGTAAACCTTC
ACTCATCATCTTTGCGttcttGCCCTCGGTCGTGAGCATGGAGAGTGGGTCGATGCCGTCAGTGATAGGGATGTTCTTAGCAACGAGATCAGGGAACCAG
GTATGCTGCCAAAGTTCGCGGCGCACTACTTGATCAAACGCACCAATGtAACTGACGAAGGCTGCAGCCAGCAGCGAGTTGCCGACAACCATAACCCCAG
AGTTCTTCAGCTGCTCGATTTCGATACCCCAACGCTCGTTTTCACTGGCCAACCCATTCACCAGCTTTCCAGCGAGCAAcAAaCGATTCTCACAGCTCTC
TTTCATCTGCTCGACCTTCAGTTTCTCTTCGGTGGCTTGTTTAAGCGTATTTtCGAGTTGTTCCAAACGCTTTTGCACTTCCGCGACTTGGCCCATGGCT
CGTGCTAACTGctCTTCAGCTTCCTCTTTCTTTTtCTTGGATGCTTCGAGAGAGTCCATCAGTGGCTTCACTCGTACGTAAATGCGGTTAAATGTATAGA
TGTTCACAACCCATGAACACAAGTTTGCAGCAGCCGACGACTTGGATGCCATTTTTtCGGCATTAAACTCTGGgTCGGCAATCAAAGGCTCgaCACGTGC
AATATCTGCTTCTGGAATATCCTcACCACGGAAAACcTtCAGAGAGTCAAGAAAaGCACcAGCGTTGTtCATCATTTtCTtGGCTCGATCCCACTTGtGG
TTCTTGTACTCTTTTTCGACTAGAATGAGCAATGCTGTCGTAACTTTGTCAACACCAGCTGGAGGCTTTGGAAGACTCTTCAACTCGGTGATGGCGGGTT
TGGATAAACAGTCGACAGcaGCCGCAGCAGCATCCATGGCTGGCTTTGCTGCGCCTAaCTCCTTCTCGGCTTCAGCAGCTAACTcGGCGGCTGCAGCAGA
CGCAGCTTCAGCcTTtACCTTCTCTTTGTTtGCGTACTCTTGCTGTACCTCAGCTCCAGCTTTTTCtCTTCCcATTTGTTCAAGCAGAGCATCGGTCGAA
GCCTGTTTCTCAGCCACTTTTACCATCGTGTGCTTAAGATCCACctGCAGCTCAGCCACATCAGCAGACGTCTTTCTAAGGGTCGACAGACCATCATCTA
GACGTGTAATCTGCTTTTGGATTTCCTCCTTTTTCGCCTTCAGCAAGATTTCGTAAAAGCTGATTAACTCCAAGAAACTCTTCGGTGTCACGTAGTTGTA
TCTTCTCTGTGTTTCAAAGTACTTTTtGGaCATCTCGGTCACAGAGATGTGGACATCTGCCATGTGATTCGCTAGGTTTTTCTGCAGAGTTGAATCTCCA
ACATCGTCCATCTTCTCCAAGAAACTACCAGCGACTCGGACCAATGCATCTCGTGGCCACGGGTGGAACCAATCAATAACTGTACAGTTAACCAATCCAG
GGAAgCGACGAGCGCGGATGCGGAAGATAGCACCGACGGGCGAAAAaCACATAATAATACGGAAGTTCAAGCGAATACGGAGGAGAAGGAAGTCCATGAG
TGCGTCCATATTGTCAGGCACGCCGTTGGcTTtGGCTTCATTtCGAAGaGCACCAAGTAaCCcATCAATATCTTCCTTCGGGAaGAGATCAGGAATCCAC
CcAGAACTGAGCATATCATTGATGTAAACcAGGAATCGCTCGTTCACAATCTGGGAATCAGTtATtaGAAAAaCAaGTGGTAATCCTTGAATACCAGCGA
TCTTGAACATCTCTTGTAGATTTTCCTTCAGGTCTTCAATGCGGAAGTTCGATGTCACAGCCAGTTGACGAACTTCAAAACCACAAATGTGAGATGCTAG
ACGAGACAGTGATTGCTTACCACTACCACCAACACCGATAAGCATGGCATTGCCACCAGGGTTGCCAATGATACGACAGATACGAGTGACGTGCTCCATC
GCATTGTCGAACAATTCCAAGTTCATCATCGAGTACTTGGAGTTATAATCATCAAGCTGTTCCACCAGCACCTTATTCAGCATCCTCATCGAAGCAACTG
GAAGATACGGTGCCTCGGCACCTGCGACCTGTGTGGCAAATGTAGTGAAAATGTTCACATTTGCACCCGCCTCGTCaCCTCCTCCAGGTTGGTCGTTGAA
AAGTGCTGCGTGATCTAGATCAGGTAGATTCTTCTTCGCCATTTCTCGAATGCGATCATTGAACTTCGCAATATCCTCGTCGTTGATCAAACGATCACAG
AAGACGCGCGTGGACTCGTGTACCCACAGCTTCGCGAAAGAGAACACACTCGGAAAAAaTTCGCCCTTCGACCGCGTCAAGCCCTGGAAAATGTTTGACA
GTTCACGCATGTTCCAGTTGTAGACAAACTTCGTTGCACTCGGGAGGAATTTGGatACCATATCTTCATGAAGCATGATCGAGACGTTGACAATGGCTTC
ACATCCTTGAATGACGTTGGACGCAAATCCAGCATTCTGGAAATGTCCCTTCAAGATTTGGTTGTAGATCGTCTTTAAATCTTCTTTGCTGGGCATCATG
CATGCGAAAAGTGCGTAGTGACGCTGCAAACGCTCGTCAaTAATAAACGAGCCTGCTGTCGGATTCATCGCCGAGAGATACTGAACGTCTACAATCtCTT
TACGGAAGCCCAAGTCGACACGATCGAAGAATGTTCGATAGTCCATGTGCTGACGAAGCAACGCCAACGCATTTTGGGTACCATATGTCTCAATATATGG
CAAGTTCAAATCGTCGATAAaGTAGATAAGTTTCTTCGTGGCTGGAGGGCCAAACATACGACCTGAACGCTTATCGATGACAGATTCAAGTTGTTGCTGG
AGCTTGAAGGAGTCGGTGTAGTAGTTCATGTTGATCATGGAGAATAGCATATCCTCATCCAAATCCCTCAAGAAGTTCTTCAAGATCGTGGTCTTACCGG
TACCACTGCCGCCCACAAGGATGGCAGGTCGTTGGCGTTTGACAAGAGTTTCAACGAGGAACCTCAAACGCACTGAGTCGTTCGTGCTGATAATAATCGA
ATTGAATGGCGTTTCAGCGGGGCCATTACCGATTGAGCCTGGGACATACTTGGGCACTTTGCTGTTCCAACTTTCGAATTCGTTTGTTTCGAGGTTATAA
AAGTAGTCAAAGCATAGGCCTTCTTTTGGATACTTGATGTTTGGGAATGTCGCGATCCACAACTCGTGGAAATTCTTTCGATAGTCCATGCTCTTATCCA
CAATGAGGGGGCCACCGAAAGCCCAAGTAGCGCAAAAAaCAAaGATTGACTCAACGACTTCCTGAGACTTCTTCTCTGGTGGGACCGTGCCCAGCAACCc
TTCCAATAGATAGCAGATTGTCGACACTTGGTTgATCAGTCTtaCTGGAGCAACTTGCTTGTAACCCTTTcGCaTAAGGTCGTAtGTGGTGTCGATGTAA
CGATCAAATaGCGCTGGTAAGTATGTCTTCTCAGCTTCCTCCTCGCGCttcGCAACCCACGATTCCATGAAAGGACGCCAACCGATATCGGTCTCGTTGA
TGAACAGGATGCCGGCGCGAGACACAGTCGCTGGAGTTGCATTCTTCAGTGagTTAATCTCGAAGACCATTCGCATGGCATCGCTCAGTGGGATTCGCTC
GTTTGACACgAGTGTCAGCACCTTGTTGTCATCCATGACAGTGTTCATTGACTCAATCCACACGGCATCAATATCACCATCCAGCACAACCCACTTGTAt
GTCTGTGACTCGTAAAATCCCTGCTCAGCGTAGTTCTTAGACATACCACGCATGATGATTGAAAGAACGCCATCTTTCCAATCCTTCGAGAGAGTCATGT
AGCCGTACAGCTCGTCGGATGTCACGgCCTTAGGGTTCAGTGTTTCATACACACAAATTTTCTTTTCTTTTCCTAAATTCCAGCACTTGGCGAGTGCCTG
CCACGTTGTCGTCTTCGCGCAACCAGCTGGACCTAAgaGCATGACGGAGTGACGGACGTCGATAAGTTCTTGGAGCTGACATACTTTCaGgATGAAAGAG
TCGTCGTGCTGTAGGTTGCTGGaTTTGCAGACAGTCACACACTTCTCACGTAAGGATGCGTTTACCTTTGGGGCAACTTCGACACCGATGAAAAGATCGG
CAATCAGACGCAAGAAGATGGGGGTGTCATTGTGAGGGATTTTCGGGGTGTTGAAATCGCGCAGTGCACGCATGAGCACTTTGTCTTCTTCTACTTCAGG
TTCCGCTCGTTTCAGCATACCAGCAACTCGAAGCACGGACTTCACAGCACGAAGACCCCAATCGTAGTGGAACTGCTTGGATAACAGTTCTGAGCTCAAC
TGATAGAGTGTCACGAACTTGATTGCTAGTGTACGCGCtgTTTGAAACCCTTCGGACATGAGCATGTTCTCGCAAATAGGCTTGAGATCGGGACGAATCA
TAGCGCAGGACCGGAACAGCACTTTCAAGTTCTCAGGCAGTTCCGTACGACCAGCATAACCAGGgTTCATTGTGATGAAGAATCCACAAGTAGGGATCAA
TGTGATACGATCTGAAGCGCCCATGAATTCGAACTCCCCAACGACTACCGGTGGTGTTCCAGCGGGTAGATGCTGATACTTCTGTTCGCGATTTGAAGGG
ATGGCGTTgAaGACGATCGCATCCTGAACGCATTTGACTTGAGTTGCAACGACACTAAGcACTTCGATATTGATTCGGTTGAATTCATCGAAGCATCCCC
ACGTTCCcGTCTGACAAAGACCTCTGAAGATATCTGCCATTGTTTGGTAGTTCATTTGATCTGAACAGTTGAACACATAGCAGCAAAGCGCCATGGCTCG
AGCAAGATCTTTCGTTGTTTCTGTTTTACCAGTTCCGGCAGGCCCAGCAGGTGCACCACCAAGGAACAGTCGAAGTGCCATCGTCAGCGTAATGTAGCAG
CGATCAGTGAGTGGTGTGATCACCAAGCG