Description :
From Genome Similarity Track
Location :
Scaffold_6:29464- 32132
Sequence
2668 bases(100 bases per row)
CTATTAGAGTTGGACGAAATGTCTGTAGATGAGTTTTACCAGAACCTGAAGGCTGGTATTGTATTCGACATGGTGATCGTTCTACCTGAATTCGAGTTGT
ACTCATTATCATTTTTAGAGAACTGTCCTTAAGGATACAAAAGCAACTCTCCATGCGTGTAGTGGATCGTTAATTAATAAGAATCATTCCAATCCCTACT
ATTATTTGGTTAAGGAACACCAGGATGTGGTGTGTCATGACCCTCTGTCGTTCTTACCTCCCGACAGAGGTGTATGTCATGAAATTGACCCTAAACCCTA
AACCCTAAACCCTAATTCCTGGGAACAAATACTGCGTGCCACGGTAATCGCTTTTGATTAGGGAAAAGTACGAGGTTATGTATAAGTTCTCTTGCAAAAA
AAATACGCGGCAGGTATGGTGCAAGATAGTAAATCTCCATCTCATAACGTCTGCCTTCTGTATGTGAAATGGTAAGTGGTGCATTGGTCATGCTAACACG
ATTCCTTAGTGCTACGCTATTCCGGCACAACCTTCATTTCTATAAAGGATTTTCTTTAGAGCAACATGTTTGGTTGTACCCTATACAACGCACTCACCTT
AGTCGAGCATATTACCAATAACTTATGCGAGCGAGCTATCTTACGCGCACAGATGTTAGTACTCCGAAAGGCATGCTTTGTTAGTGGCTAGCTATGAAAC
AGGGACAATACACCAGCTGTTTAATACACTGGCTATACTTAAACGTCTAGTCAAACGACTGTTGAATCATCAAGAGGTCCATCGTCGAGTGGAACACAGG
AAGACAGATGTAAAAAATCACATAGACCTCTTTGTATGATTTGCTAGCGGAGGTTAAGGGCATCCTCACCAATAAGATCCTCGCTAATGCCTCAAAGTGC
ATATTTGGTGCTGAGGAGGTTCCCTTACTGTAATTCTTCATACGGAAAAGTGGCCTGACAGCAGGCCCTGTATAGGTTAAGGCCATAATTGATTAATGGC
TTGGACTTTCTAATTTCTTGCACAAGTATAGCTCGATTTACGCTGACATGACAAGGACATTGTCCTATCTCCTGAAAAAGACATAGACTGATGCTGGAGT
AGCATGGGATATGATGATTTTAAAGACCTTAAATGAGATCTCCTTCATGTCCCGATTTTTGTCCTGCCTGATCCAGCGAGGCCTTTTAGTGTCGTCTGCG
ACGCATCCGATTTTCCATCGGCAGTGCTCTGTTACAAACAGCTATTGAAAGGCGTATGTGTTTCATCACTTTTACTTTTGCCAGCACAAAGCTGCTGAAA
GAATTGTCTTGATCATGACAAGGTGTTACTTGTTATGAAGTTTGCTCTGGTCAAAGTCAGAGTACATCTGCTTGTCTTTTAGCCGTTTGTGATCTTTACT
GAATATGCTTCACAGCGCACTTTCACTCAGTCATCTCACTTCTCGCGAAGAATGACTCGTTGGTTTCCATTCTTTGCGGAGTAAAGGTTCGAGATGAAAT
ACAATCCGGGGAAAGAGAACGCTTTAACGGATGAGTTATCACGCAGACCTAATTATGATCGTGCTCATGGGAAAATCTTGTCGTTGTCCATTTCGGACCT
GATTCGTGCGGCATATGTCCGAGATGATCATTGTATATCTTTGGGTTACGTGCTATTGAGAGCGAAGAAACTAAAGAATTAAATTTGAAAGTCTCGGCAC
GATTGCGTGCGCGGCATTATCGATATAGTATCTATCAGTTTCTATTGTGCTATCCCACAGATACCGAGGATACTCCTCGTACTGTGGTTTTATGTGATGA
GGTTTTAGCGTATCGCATTCCTTATAAGGCGCATGACGCCATATTCAGCGGTCATCTCGGTCGCGAAGTACCTATTACTCGGTTAAAGTCAGAGTTATTG
GTGGTCCAAAATCTATAAGTGGGTCAGTGAATATGTGCGCACGTACGAAACGTGTCAATGGCTCAAAACCTCCGCACATGCATCTGCGCCACTGGCGATT
CTACCGGTACCCAAGCGTGCTGGGATCCCATTCGCATGGATTTTGGGTTTGGCCTTCCGATATATTCGTATGGCAACACTGGTATTGTGGTCTTTGTTGA
CTGCTTCATCAAAATGTCTTATCTAGCGGCTGTTTTGAATTCTATTTATCGTGGAGGTACAGCTCGTCTGTCTTTCGATTGAGTGTTTCGCCAACGCGGC
TTGCCAGTATCAATTTTATCGGACCGCGACCCTCGTTCCACGAGTAAATTTTTAGGAGTTCATCTTTCACGTGATTGGCACCCGTTTGGACATATCCAAG
TCGGATCAACCTTAGACCAATGGTCAAATCGAGCTCGATAATTAATCGCATTTTCGAGGATATTCTGCAAAGCGTGTACGCAGATGCGCCTAAGTGTTAG
TCCTTTTTCTTGAGTTTGCTCCTTAAACTCTGTGCACGACTCTACGGGCTACACATCATTCTATGTCAGCTAACTCACACATCCGCGCGTCCAGTTAACT
CTCTCACACACTGTAGTCTTGGGCTTGGTAGGGGAAAACTTGCCGATCAACTTGCTGGTGTCATTTTAGCTTCTACCCAGAAGCAGGTGAGCCAGTTTCT
CACTACAATCTTTGGTTCTTGTGACATGTGCGTGACGAAATAGATGAAAGACAGGATAAACTAAAGGA