Description :
From Genome Similarity Track
Location :
Scaffold_37:2946- 37264
Transcript NameFunction/comments
Phypl_g1447hypothetical protein
Phypl_g1448hypothetical protein PHYSODRAFT_499950
Phypl_g1449hypothetical protein PHYSODRAFT_302676
Phypl_g1450hypothetical protein
Phypl_g1451hypothetical protein PHYSODRAFT_309032
Phypl_g1452hypothetical protein

Sequence
34318 bases(100 bases per row)
GTTTGCGTACATGCTGGATGCGGTACTCCTTCCGCTGAAGCCAAATAAACTCACTGTTTACGCGGACAACTGTGAAGGTCAGAATAAGAACAACTTCGTG
TTGGGCTTCCTACTGCTGGTTGTTCAGCTCGGGTGAATCGACGAGGTAAACTGCAAGTTCTTCGTCAAGGGGCATACCAAGAATACATGTGACCGTGGAT
TCGGGCAGATGAAACGGCATGTGCAGCGCCAAGATTGCTGGACAATCGACCAGCTGACGAAGGCCGTTGAGAAGTCGTCTAGTGCGAACCAGTGTATACG
TGTGTCGGACGATAGGGCTTTTCGCAACTACAAGTTTGTCGTGGATGAAATTTACAAGAAGGTCAAGTCGATCCAAAAGTACCAGCTCTTTAGAATGCGG
CGTGAGACGCCCGGTGTGGTTGAATGCCGAGTTCTTCCCGAAGCTAAGCCTGTTCTGCACGATCTGAGACGCGTCTACGACAGAGTTCAGGTTGACGAAG
ATCACGCAAAACGATTGCTTGCTGTGTACCTGGAAACCCTTCCACGACCGACGATCAACGCCGAAAAAGCAACGCAGATATACAAGTCAATCCGGCAGTA
CGTTCCAGCAGAGTTTCAGAGTGATAGTCTGTATGCGGCACCAAGTCCAGAGCCAGAAGACGAGGCAAAAGCAATCAAGAAAGCGCGCCGTGAACGCAAG
AAGCACGATCCagacagcaacaagcaggGTGACACTGATAAGTCTTCCGACAAAATGAAATGATACCTAACGCCATTCTGAACGACATGATACTTATCGC
CATATTCAAATGACTATACCGTATGTCACTTTTATGCTACCATTGCGAATGCGAACTTAGCGCTGACCCCGATTTTGAGCATGTTGCAGAGCTCATTGGA
CGAAACCGTCTATATATTTGGATTCCCCGCTTAATTTTGCCCTACATCAGCCAATAAAAGAAAAATACGAACTTAAGAAAAAATGCATTTTCAAATTTTC
ACATGACCATTGCTCGGCGGGAACCTGTGCTGAAGTTGTACCAAGTACATGAATCGAAAGATCGCTAGAAGCTCTTTCGAGAGCACTAGATAGATCGAAA
AGTAGGTTTATTGGCTTAGTATCATTTCGTTTTGCGTTGCCTCATATAGTCCCAGCAccacagcttccagcagcgagtcaTTACCGAACTCCAGACAACG
CCTTCCGGTAAAATCATATCCGTCGGATCGTTCTCGAGGTCTGCAGTACGATGAACACCAACTTCAAGCCATGAAATTGACGAAGACATGCGCTCGCCAA
CCCTTGAAGGGCGGCTGCAAACCGCTACCCTCTCAAGCGCGTGGGAGCGCTAGTCAACCATTGACGCAAATGCCATCTATCGTTGACACTGAAATTTTGA
AGAACCGGCCATCTTCTGTCGACTTACTGCGTTTGACGAGCGATGTTCGATGCGCTCTCGAGGCCCAGTTACAGGCGGAAGAAATTGAACGCGATAACCG
TATTGAAGATGTGCTGGTAATGCATGGAGTTTCCGTGCTGGACATGACGACCGAGATCGCCGACCACAAAAGCGACGTGCCTAAGTATCAcctcgacgcc
agcaagcaACGCGCATTTTCAGACTTGATCATCCACCACGAGTTCACACTTGAACAAGTCGTTGAGCTTGCACGGGGACAGTCATAAAGCGATCCTCGTC
CAAACAAGGCATTGTCGCCTAAGCAGCTTCATTGACTTCTGACCAGATACAATCACCGCGACTTAATATGCAGTGCAGCACGGCTTGGGCTGAACCCCGA
ATGGTCAACAGAAGAACcggagcaacagcagatTCCACCGAACCACAAGTCAGCAGATCGCCACCTCAATACAGTGATCAAAAGTGtccgagaaggccaa
gacggaggTCCGtacctggtgctggacgaaaGGGTACTCGGGTGGCTCAACCAAATCCGGATCAGCCCCCTTGGTGCTGTGCCAAAAGCACACAGAGATC
CACAGATCGAGACCCGCCTGATTCACGATCTCTCGTTCCCAGTCGGCAACTCCACGAACGATGCCTCTGTCAAAAGTTCATTTCCTGAGATACGTCGCAG
CCATCGCCAGGCGAATTGAGGCATGCTACGAGCAAGACCCGACAATCGTTGCTTATATCATGAAAGGGGACGTGAAAGGAGCATTCCGTCATTTGACGCT
AGTCGCACGCAGCGTGCACTGGATGGGAGCACGTCTCAAACAATTGGGTGCAATCATCATCGACATGTCTGCTCCATTTGGCTGGACAGAATCACCAGCC
CACTATGGAACCTTTGGAGGGGCTATCTCGTGGTTACTGGGTCGCGAAAGCCCTGCAACGATGACAGCAAACCCAGCCGACCACACTCCATTTTTCGCGT
ACGAGTGGGTGGATATCACGTACTGGTAGAACTTGATACACCTGGACGTCTTCAGGCTGCAAGCACAGCTTTGCGCTTGGCAATGATGGCAGTTCTTGGT
CCAAGAGCCATCAATGAGAGCAAATTCTCTGAGTGGAGTACGAAGCTTGAAGTTCTTGGATTAGAATTTGATACCGTTCAGCGCACAGTCTCGATGCTAA
AATCAAAACTCTCAAAGGCTCAACTCCGCGTCCGAAGCGCGGCACGAAAAACTAAATTGTCTAAGCACGATATGCAGTGCCTGCTGGGGAGTCTACGTCA
CGTCGCCACCTGCCTTCGAAGAGCAAAGCCATTCTACCAACGTCTTCAACAAGCTACAAATAAAGCGTCACGGAGGGGTAGCATCACCATCGATGCGTCA
ATACGGCAATACCTAGAATGGTGCGATGCTATCCTTACTCATGGTTGCTCGTGGTCACTTCCAACATCGATGTTCTGCGTCGAGCCATCTATCGATGTCC
ACCTATACATGGATGCAAGCAACCAAGGGCTTGTTGTCCTGGATCCCGCACGCCGCCACTACATCCAACTAAGGTatgacgagctcgagcaaTGGCTAAT
TGAGCAAGCCTCCGGAAAGGATGGATTTAACATCAACGTCCGCGAACAATTCTGCGTGGCGCTCGCATCATGGATATGGGGTCCTCGCTGGAAACAACTA
GGCAAATCTCTAATTCACGTACGCAGCTGGACGGACAACACTAGTGCTGCAGCCTGGACCAACAATTTGAACAGCACCAATCGCCTTGCACAAGAGCTCA
ACCGCGCCATCGGCTTCGCTGAAGTCACTCTCGGATTTCGTATCTCTGCTGGACACATGCCGGGGGCTTCCAACTTTCTCGCCGATGCCGGGTCACGAGC
GTGGACAGCACCCCATAATAAAGCCTGGACTAACATGAGTTTGTCGTGGACACAGGACCCGATATCCGACCAAGTGCGACATATCTACAAAAAGTTCTCG
ATGATCTGCAAGCCCGATCACTTGCCGACGACAGCCACCGAAAGTATGCGGGAACCTGAAAAGAGTGGACCAGTTGGTGCAGTGCGCAAGGATTTTCACC
ATGGCTGGCAGGCAACAGCCATGACGATTCCCGTCAGCTTGCATTTTTTGCCGTCTCCCTATGACTACCACACAGCAACCAGACCGGCAAcgcttccagc
gccgtgctgtcCAAACTCAGCCAAGTTTCATGGTATCATCGTCGATATCGGGGACTCTCAGTCGGGCTCCACGCAGAACATGAGCTTGTTATGCAAGGGA
TGCTTAAGGTGTCACGACCTCCAGCCAAAATAGAACCTCTCACCCCAAGCATCCTTAGACGCATCCGCCAAAACGGCAACTTTAGCACCGCCCATGACCG
CGTCTTGTAGGGGGCTGCTCTCATAGGCTACTTCTTTCTGTTACGCCGCAGCGAATATTTGGCAGACAAAGGACGTGTGAAGCCGTACATTTTACGATAC
GCAGACTTGACGTGCTACACACAGGACGGGAGTTGAGCCCGCCACGAGCAAGAGACAACCGCGGTTCATGTTACGTTTTGTGGTAGCAAGGCCGACCAGT
GCGGCAAGGGGGAAACCAGAGTTCTAGAGCGGTCCGGTCTCTGGTGGGCATGTCCTGTACGGGCAGCATGGCTTCTGACTaagcaccagcaacaccaaGG
CATGTCAAAGAATGAACCACTCTGCAGCGTCGAATAAGGCAAAACAATCACGGCTACAAACATGACGAAGGCAATAAAacaagcagcgacagcagccgGC
GAGAACCCCGATCGATACGGAACCCACTCAATGCGTAGTGGGGGTGCCACCGCTCTCTTTACTGGAGGCGTCGACCGCTTGGCCATCTAGCACTTTGGAC
GGGGGAAGTCCGAGGCATACGAGCTCTATACGCGTATCGATGGTCAAAATTTCTCCGGTCTTTCAGCAAACATGATGTCAAACAATCACTTGGGCCCCTG
ACTTCGACAAGCCAGGCTTCGCCTTCAATACGGGCTGCTCCAGGCCGCACTGACCCGGAGCGGCTTAACGAAACCAAAAACACGAATGATTTGTGGCCCC
CGGCCGTGAGCGACAGTGGAAAAGCACTTGTGTTTACAGGTGACGACTATTACCAAGCCCGGATATTGCAACTTCGATGTGCACTgccgtggccgacgcc
atcacgctcgtggccgacgagtggacggagctgcagggcagACACCGTGTCGCTCTTCCCCAGTCTGGCTGACAAGCTGACCATCACCGAGATGGGATGG
CCCAGCGCCGGAACCGCGGTCAGCAACACGGGATCCGTCACGCGCGCCGCGCAGTTCTACTCGGACTACATGACGAGAACCTGGATGCGTCCCGCAGCCA
CTACTTCCAAATGTTCGAACTGCCGTCACGCACCGACAGGGTGTTTGAGGGGCACGTCGGCATctgcgacgaagacggcaacGACAAGTTCACGCTGCAA
GCTGGTAAATCTGTAGACAAAAATAGTCGTACGACGTCCCTGAAGTGCCCAAAGTGCCCACTTGATTCAATCAAAACATCAATGTTCCAATTGCTGTCTC
CTGTTCATCGTCACAGGACAAACAAGACCCAACCCATAGTACGTATCGTGATGCGTCCTCTTACTCTCTTGGATCTACAAGCAACCACAAGGAAAGAAGG
CGTCATGCAGCACAGAACGGTAAGGTTTACCGCTTGATTAGCCTTGCCAGTGAGTGTTGCACCActactgttgctgctctgctACATTTTAAAAAGCGTG
TCGTGGTACCAGCCTTCCTTCGTTACGGTATAATGGAGCCGTATCACGATTACCTACTGCACCCCGGCGGCGAGACGCAGTTCCGATTGATGTCGGCGTT
CTGGTGGCCATGCATGGAGAATGCAATGAACATACGCGTCATGTGATCGCCACGACTTCCAGGCAGAGCAACTACAATAACAGTTCCATGCGCACGAAAA
GTAGACCAGGCTTCGCCAATCTTTTTGTTGGAGTGACCAAGCAGCGGACCAATTTTGTTGGTAACATACTATTTTCTTGGTATTACTGCGTGATCTGCCC
GAAAGCTGGCTTGGAGAGCGAGCATATCTAATGCTTCATCTATAGTAAGAGCTCTATCACGCTGGGACTTCACGAATGTGATTGCCTGGGCGAGCTTTCT
TGGCTTGGCGCGACTTTTTTAAAGCCAAGTGCAGTGCCGACAACTGGAGTTGAAATGTAGTCTTTCGATCCGGTTATGCTATTTTTGACTCCGATTTGCG
CGATAAAAACCCGATGACCTTTATTATTGAATATTCTAATCGGAATATAATGTAGGAGGCTATTATAATATCAGACGACGAAAACCATTTTCGGTCTAAA
CGCCAAAGTGCGAGGTTCGAGTTGACTACCTATCACATCGCTGTCTATCCCAGCTTCATTTTGAGCTATTCCATGTCTTCAGATAAGGCTTCAGTCGACC
ACAGTGGCGTTTGGCGCGAGACAACCAAGTTCAAATTTGAAAAATGTTTTTCTGCTTTTGTGATGATTATGATGTGTTTAAACGCGAAGAATTGATTGGT
GACGCCTGTTTGCGTCAATTCGAGGTGGAACAGTTTCAAGTTGCAGATAGTTTCCGCAAAACAGCAGACGTAAAAAAACACTTATGTGACCCACACAAGG
CTACACTTGTCGCGATAAGTAAACCGACTTTGGTTTGCCCCTGTTGAACGGTGCCGCTGGCTGTTCCCCGCGTCGTTACATAGCTTGACAGTCTTTAGTC
ATCGTCATGTAGCTCCACAATCGTGACGTTATTCTTCGCGCTATGGTACGTCAATGTCACCGAGACACTGGCCGCGCCGTCACCCCCCTTTTCGTCATCC
ATATATGTGGGCGTTTGGTGATGGGGACCGGGTAAAAACAAAGTCAACTGTTCTAAACGCGTTTTCTCGAAACTTCACTTACGTCCCATTCAACCGGCAA
TATCTCCACTATAATAATATTGAAATGGACGATTTTGAATTACGTCCCCTCATATGTTGGTCAAACCGGATGATGTTATATGCTGAAATACCGGAAGGTC
GTGACTAAAACGAAATTAATATGTAGTTTGGCAGGTTGTGTACCACATATTCAGCCATCTGACTTTTCTTGACATCCTGAAAGCAGCAGGTCGATCGGAG
AAAATTGACGCCGCAATGTCTTCGCCCTGTCGACCTCTGCGAGGACTGTTGCGTGTTCTTTACGGTTATATTCAATACGCAGTGTACACCTCGGTTTACG
CCTATGACCTTTTGATCATCTCTCCGTCCAAACAAGTCGTTGCTCGGGTCAAATTGGCCATGCATTCCGAGTCCCAAATATCTGATTTAGTGGGAGTTTT
GTTTCTATTTGGCTGGCCTTTTATGCGATGTATGTCATGAGTTAATCATCTGGCTCTAACAGTTCTAGGTTCTCCCCTCCTCCAAGCGCAATGTCATTGT
CCCTGGAGTAATCGAGATAGTGTAGTCCATGCTTGACGGTATTCCAGGGAGACTTACCTGGGTTATCCAGATACTGATTGATCTCATAAATAAGTAGGCG
AGGTCAGGTCTCATGCCAATTCTCAGGTACATGAGATACCTACCGCTTCTCGATAGGTTTTGTTGGTCAAGTAGGCTTTCAAGTCGTCGTCCCTAGGACA
GTCCGCTTCTCATTGAAAGAAATGCTTTTGGCATACCTCCCAGCATCGAGACACAATCGATCACTTTGGTGGTATAGATTTTCTAGTGGATAAAGGTAGA
GCGATTCAGCGTGCCAAGACACCCGACGCTGCATTGGTGGATACACCACCATGTTCTGTAATAGTCCTATTAACTAGGTCTCAAGAAGACATTACCCTAT
GGTGCTCTTCACGACGGACGCAGCGTACATTGCACTGTGCTTCGGCATGCAAGAGCTTATCTAAATTAAGCTACTGCTGTAAGAACTAGGCTACGAGAGC
TCAATTATGAACCTAGCTTCTGATTGATCCCAATGAAGTTAGTGTAGCCGATAAATCCGTTCAACCTAGGTGCAGTCGggtggagatggaggaaAATAGA
TAGAATGCCGGCTCCTCGTCATATTCCCAAATGGAGAAGCACACCTTAGCATAGAGATGAAAAACGACGACTGTTCATTCGTGCCTGCGTCGTCCCGGTG
TCTATGATGGCTGTGCCACTGTCGAAGACGGTCTTGATGCGAAATGGTCCTTCGGTGACTTCGTTAGTTTTCGTTTGATCACGGGCTGGAGCGCACAGCA
TGTTGTGGTCTCCCGTCTGATATAACAGCTTGATGCGCTACAGGTTTTCGCGATCACCCAGATCAACAACCGTGAGTACTGCAGTTCGTGCTTTCATACG
TAGTCGGTGTGagacgaggacaagaacaACAGCGGAGGATGTTATGCATTTTTTGGCTGAGAAAGACTGTATTGTGCTTGATACGGCCTGTACCGACAGC
ACGAATTCTGGACTGCGTACAAAGCAGCGTTTCTTGGCCAGAAATGGATCCTTCGTGGTGCCCACAAGGACAAGATTTTGCGGCTGTTGCTAGCGGATGG
TGTCGCTAGGGTTGAGAACGTAAAGCCAATGACTAGTGGCGAAGGCGCATTACGACGGATTGTCAACATGAACGAAAGCTACATCTAGAGGATGAAAAAG
GATGGGCAAAATCGGTTTCAAACCGAATCGATTCGAATTGAATCTGGATGAAACCGGTTGCCAAAATAAGAGATTAAACCAAATCAAAACTGAATCGGTC
CAGTTTTGGGTGAGCATCATTGAACAAAACGCTTACCAATGGTACTTCAATTAGGATCTGTAATctttgatgctgctgataAATGTGATAGATCACAACG
GGTCATCGAGATTACCACGAGCATCCGATGCCTAGATCAGTCCTTGGTGTCCCAGAAAATCACCGGCACCGTGAGTGTCAACTGGCCCTACTTCTTGAAG
GGCGTGCACCGGGCAGGCTGGCGGTGGTTCAACGTGCCGCTGAGCGTCTGCGATTGGatcacgagcagctccatcttgtGGGGCTGAGACTGAAACAGCA
GCTGGAGGTAAGCGAGGAACCAGCAAGTGCGGTTCGTCGTCacgaaggagacgaagacgggGCTGCAGCACACCTATGCCCATCAGTCCTGCTAGTTTAA
CGCATCGAACCCGCAGTAGCATCCGTATCAGCTGCATTAAATCACCTTTATACTTCATATACTAGTAAACAGCATCCCGATATTTCAGGTTGCTTGGGGG
GCAACCGCTAAATACCGGTGGTTCCCACGGTTTCAAGGACCCCCACCCTTATGCTGCTATGCAGTTCCCGTAGAAAGTGAGGCAAACTTTAAGCAATATA
CCACGAAAGTTCAGTGATAGAATTTGACAAAATAACACAGTCAGTGGTGACAAACGCAAACTGGAGTGTTGTGTTTCTGACAACTCAATATATGCATCAT
TCGGTAACCATTTAGCAAACCAATTTCCTCGAAGCACGGCAACCTCTCTTAAATGCTTTCATCATCTGAATTATCGCTATCCTCCAACTCTGATTCAGGC
TGTGCATTGAAAACGAACTTGTCGTCTTGCCCGTCACTCTTCCGCTCCTAACGTGCAAACTCCTTCAACTCCACCATGGCGGCCTCCACAGTCGGACGTT
TAGACGGATCGAAAGCACACAACGACTCGAAATCTCCATTATGCGTCAGAAAACTCGTTGGGTTTCTTCAGGAATTTTTTGTGCGTCAAGTGATGCACGA
TAGCTAGATCGGGTAATACCCCCCACGGTGCTCTACCTGTCACTGCTTCAACCACGCACATACCAAAGGAGTACACACCCGCTTCTTTGGTTGACGCACA
CTCGCACAGAGCGGCCACACAAACTAACTGGCGACGCACGTGAAGGTGGAAGAGAGGTTCGAGGCAAATCTGAGGGCCAGCGTGGCAAACCTCATGGACC
CGCCAAAcgtgcgccgccagcaggcTATCGACGCAGAGAACGAAGCCTACGATCGAGCAATTAGCGCTTATGAGAATCTCCATGGCGCCCGACAGCTACA
CGGCGCTGGTAGTCCCGCCATGCATACAGCCGCCGGGTGTTTCCGGATTCAATTACGGCGTCTTACTCAAGCTAGATTTCCATCGGAGCAGGCTGACAAT
ATTTGCGCGGATGCCTTCCGATTAGCCTTCGCTAACGAGCGTGAGAAGCGCAGACAAGTCCAGGACGACCGCATCGACTCATTTCGACAAACTCCACGAC
AacaagcgcaacaagcgcAAATAGGCACCCAGGGATCAAGTAGTAGCGAGGCGTCGTCTACATCAGCCAATGATGAATCAACGGAGAAGTGAAGGTGGTC
AAGGTGCTGTATTGCAGGCAATGGAAGCTGATGAGAGCAGCTCTCCGTCAGAGTATGTTCCGTTGGGGGAGATTCAAGCGACGCATGAAAAGGTTCTTAG
GATATGATTCACTGGTAGGCAGCGATTATGGATTCAAACAGTGAGCATTCAATCTTCAATCCATTATGTATGGTAACTGCTTTcctactacatgtacatg
tatctgTGGTCAATCCATTGTGTACGCTAACTGCCTTCTACTACACGTATATGTATCTGTGGCCCTCCTCTTTGAGTTCGCGTACACCTATAGTATCGAA
AACCCTTAAGACCGGTGTCGTATGCTTAATAAGAGGTCCGCAAAATCGAACTTACTCtaaagctgcagcagcagcagaagatcTCAAGGTGCAGTagaag
aagcagaaaccacaccagaagcagcagaaggtATGCCCGGTAAGTAAGCACTGCTCTAGCTCCGATGAGAGCACAGATCCCGAGATGACCTTAACGACAC
TTGTTTCGAACGCCGGATTGTGGACGATTGTTGCCGTCTCCCTCAGATGTTGGCCCATGACCGGATACTCAGCGATTAGCGCGTCAAACATGAGGCGCAC
CTCTGCCATGTCCGTGTCGTCGCGCTGCAATCGCTTACAGATGCTATCGAACTTCTTCTGATGATCAAATAAGGCGACTAGCTTTCTGTGCTATGAATCT
GTTGGAATCAGCTCTTCGACTGCATCCACCTTCTTGATCTCACCACGAATCCGAAGGTAAATTTGAACCATTGTGAACGTAGATGACCAGCGAGTGACGT
TCCTCTTGACGGGCCGAAGTTCGGTGTGCTTCTTGAACTCGGCTAAGTTGTTCTCCAGACACAACTCTACCATTAGAGTGTTCACTTCAGATATCAAAGG
GTCACACGGCTCCAGGAACTTGTCCACAGCGAGGTTGAACCTGTGTCTAGCACAGCCGACGAGAGGCACATCCATCTTGTTTACGATCGACCTGTTGGTA
GTGCGGTTGTCGCCTACAAGAAAACACACCATATCCATGGTCTTGTTGTATACGTCGAGGGTGTTCTCGAAcagctggacgtggacgtcggCTGTTTGAG
TTCCGTCGGCTAGAGGGGATAAGCCCACCATCCGTACGCGGAGTTCACCATCCGCCTCGTAGCAGCAAATAGCGCCACGTAATGCACACCGGCATGCAAC
CAGCCGTCGAACATCAGGCCGAAAAGCGTTcccagctcctcctccagctaGTGACTTGATCGCGATACATTCCATGCACTTCTGCACAGCCTTGACGGTT
GCGGTTCGTAGCTTGCTCATCGCTCTCGTGCCCgcgtcttcaacttcgtGCACGGGCATGTTCCGCATGGTAATCCACCGAATCCTATGGAACATGTGAC
TGGGCTCTTCCGCCACAAACCCGAAACTCTACAATGGACGGTCGTAGCTGCCCTGCGATGCTTTGTACTGAGCGGAGTAGCCTACATGCATCCTACCAGG
TGAGCGATGCGGTTGGAGTTCCCGGTTCCCGTCTGTGAAGAGGTGGCCTGGAAGGtgaagcagacgaagacgactTGAGGAGAAGATGGTAGATTGAGTT
GTGGTTGCTGTGTTAACTTGTCGGTCCCATCAAGGTCTCTCGTGGCCATTCAGCAgtagatggctacattgaCTGGCTGCACATACAAGTGTGTGGCTAC
ATATAACCTATCGAATATATTCGATAGTCTGAACGATAGGTTTCATGTGGTCTACACGAGTAATGCTTTCCCATGGTCGCTCGCAGTCTTCACACCGTCG
CTTGTTTCCGGTTGTTGCCACATATGTTGCAGCGAAACAGTCCTTGGTCCAGCGGTGCGTAGAAGAATGCGGCAAGTAGCTTGTTGGTGACTATCGTAGC
TGAACGAGATTGAGTTGTGAGGTCTTGTCAGACCCGAGGCTTGTGAAACTCGGCTGAACCAAGAGCTCCTGGCAAGTAGCTATCAAACAACGCTTATGTG
GTGTGCAAGACCCCAGTACTGATGCCATCGGGGATGTGGTATTATGCCATAATGAGAGGATTTGTCGGAGGGGCTTCAGCCTCCGGACAAACCGCTTTTG
GTTATATTAATTGTCAATAATTGGTACAATATGGTATTGTAATGGAGACAGTAGGGTCAAATAAAATAAAAATTATTGGTCAAACCATTTATTAATTGGT
TCCCAAGTATTATTTCAGACCTCTGGCCTACAGTGACTCTGACTATGCCAACTGCCCCGACACGAGACGATCTGTTGGTGGATACGTGACTATGATTGCC
AACAGTCCAAAGTCATGGCTCTCTCGTAAACACGAAGCCGTCGTTCTCTCGACTACCGATGCAGAATATATATCCCTGTATCACTGCATGCAAGAGGTGG
TATTCCTCAAACTTCTCCTCAATGAGTTGGGTTTCGCCACAACGCAAGTCAATGTAATTCATGAATACAACCAGAGTTACATCAAGGTCTGCTACAATCC
GGAGCTGCTTGGACGGTTGAAGTACATACATGTTCGTTACTGCTTTGTGCAGCAGAAGGTAGTGCGACACGAGTTTAACGTCGTCTACTGCAATACCAAC
GAGATGGTGGCAGACACCATTATAAAAGCACTAGATAAGCATCAGTTTAGATAACTACGTGTAAAGACCAAGCTCAGAATGAAAACCAAGCAGTTCATTC
CATATAGTGTACGAATATATACTAATGCATGAAGCACGCCTACTTATAATGCGTTCTTTTATTTTCCCCACGGGGTTTTAGTTTGTTCGCAGAAAGGTTT
TCCTCGCTGAGGCTTCCCTGGTCTAGTACCGAATTCATACGGTACATGCAATATCACCCCATGCAGGAAGCACAATTTGCTAGGAATAGTTCATTATCGC
TATGGCAAACCCGCGGAAATCTGTAACGACTCCTATCATTTACTTACCTTTAACGACTATGAAAGGACGAACAAAGGCGACGAAATTGACCAAGTCCCTG
AAGCGACACgcctgtcgtcgtcgttgtcatACACGACACGAGTAGTGCCTTGGACAGTGAGAGTACTGGCCTGGCGAACGAAACTGTGGTTGCCCGCCGC
AACCAAATAGACGCCATCGAACAAATCGATCTCCaccgtcatctccagcaagGCTCCCGCAGCCGCCTTGGCCCCAGCTCCCACAGCCACCTTCGTCGAA
CGCGCCATGGGTGCCTcccggcgctcgtgctctgTCCTTGCGTGCTATGGGACTGTAGCGCCAGTACGCGCTgcggcacgtgctgctgcgcgcctCTTTG
GCTTCGCGCGCTGGTGAGTGGCCGTCCTAGGCTTCCGTTTTGAAGAAGCCGGCACACCAGTCGCCGCTCCAGTCCGCGATGCACTTGTGCTTGACGACTA
AACGATGGGCATGCCCATGTCGTCCTTCTTACCCAGTAGGCAAGCTACCAGGGCAAAGTCGGATCGGATGACCCACAGGCTTCCAAATGAGTCGCGGGCG
ACTAACATTTGGTACCTTTATCGTAGATGTCGTTTACTAAACTGATACATGTTAAGGCAGAAAGGCTATTGAAGTCAGCCTTTGACATGGTACAATGTAC
CAAAATACCCTTTAAAAGCTGATGGCCAATCATCAAACACTCGTTGAAACTTCCTATACTGGTAATCAGTATAAAATAGTAAGGCATAGGGTTTAGTAGT
AACTATCCTGTAGACAAGTCATCATATATCtgctggcaagcagctctcgctgctctAATACCACCACTTCGTCTTGGACACCTCTCTACTCGCCCGACTA
CCTTCTACGTATCCCCGCCATAATAAGAAAGCCCCTATAACTTAATCTATCGTTTTAGACAGGCATTCCCTGTCTATTTATCTGCTGTGGGCAGTCAGCC
TGCACACTCTCGGCTATACGACGGGAGTCGTTAATCCCACCCCCGGTTTCCTTGTTCCCACCCCGTGTGCCAGTAAAACGGTACGACATTTCTAATCTGC
CTTCTCATTTCTATAACGAAAGCGGGGAGAGCACGACGTACGCGCCGCGGATCAAGCGTCGGACTCCGCTCTGCTCCCGTATGATGTCGAGTCCAGCGAG
CGTATCCCGGGTcgcggggggggggcaccACGTGGTCAGAGGGCGGGTTCTCGTCGAGCAAGAAGTACGTGGAGCTGGCTCTAGGAGGCCCGGTGTCGAG
CGACGCCTTGCCTGGCTGGATGGCAACCGGAACTCGCTCGTtgacgacgcgctcgagagGGAAGACATAGTCCGTGGAGACCGCGGGGCCATCGTGCCGG
AAAGTCTCGAGCTAGCGGCTATGGAACGTGGCGACGAGCACGCTCGAGTCGGACCAGAGGGCCAGACACGACCGCCACCAGCAAAACACCAGGGAGCTGT
CCCTGGCCAAGCACACACACGCAGCGTAATTCCTAGCGGTGTGGGTGCTCagcgtcaagctgctcgtgcgctAGCACGTGAACTGGAAGGAGGTGCCGCA
CGAGGTCGCGACGGACCCtgcgctgcgctgccgctACCCGAGCAAGCACTGCCTGCGCACGCGCACGGTCAAGAAGACGGGCTCGCTGCACAGCATGTGC
GCGTTCCACCGCGCCAAGGCAAACCGCAACCAGCGCCGactggagaagcgcaagcgtcTGCGGCTCTACAGCACGGACAGCGTCGCCGAGGTCGCGCACC
TGGCCGCGTCGGCGAGCCAGTACACGATCAAGCAGGAgccgtccacgtcgctgctgctgtcggcgttCTCGCCGAGCTTCAAGGGtttgctggacgagtc
gGCGCCGGCTCCGCAGTTCCATTCGCCGCGCGAGGTGGCGAGCGCGTTGGAGCCATTCCGGACGCCCAAGGCGCTGTTCCCggaggacctggaggagctg
TGCGAGCTGGTGGATGTGAACGTGCGGCAGGTACGCGCGTCCGAGCGCGGACGACTTCCGCTTGCTgtcgcagcttctgctgtaGGCGGCAGTAGCGCGC
AACCCAGGGGTTGTAAAGTATTTAGTTAGAGGAAGGACGCGTGTTGTTGATGAAATGAATGCATGGTGTTCTTTTATTTTGATTGCCTAAGTATGATAAG
TGATTGGCGCTATCATGTACGGTGGCTCAACTGTGCGTACCGATGCTGACGAGAGAGGCGGAATGTCTGGTAACAGCTCAAAATCTGACGGATCCCTCCG
TGTCCCCGTGACACCGGAGCCCTTTGTGTGAGATTTTTTCTTGCGTGTCTTACTttcagctcgagctgctctACGATCTGGAATTTTTTGTGGAACTAAT
ACCACTGGGGGCATAGCTGGAGATATTTTGGTACGATCGATCCACCAATGAGGGTGAAATTCGTGGGGTTTGAGGACCTGGTTAGTAGTCTGGAGTTCCC
ACAGCCTGTGCACACATGGAAGTCCTATGGTGTGCTTGAAAACTCCGGTGCATCCGGTTTGACGAATACGTCTCAGTTGATCCAGGCATTCTAACAATGC
AAATGCATGAATGACACTTTTAACATCACGGAAAAGTTCTTCGTCCAAGATTCGAACGCTCTTTACAATCGACTGGGAGACTGCATGCTTGTGGTTTCGA
ATCGATAATTCCCACCAAGTCGTCATCCGTTGATAAATGGTAAGTAAATCACCTTCAGAGTTAACAAGCCATTTTTTGAGAGCCGAATGATACCCTTCAA
CACGGGAAGTAGCCTGAAGGCCGAAGTGCGTAGCTTTGttggtccagcagcgaatTAAATTGTATTGCCAAATTTCCAACCAGGTCTTCTCGATGTAGTT
GGCCTCTCGTTTGCACAGAGTGTGCAGGTCCTGTCGACGTTGTTCGTACTCCTCCTCAGTTTTAGAACTCACTACTTCACGAAAAGCATCGCAAAATGCT
ACATGCTCTTCGGAGTCCTTCTTCACCTCTTTATCTGCTGTCGATAACTCGTCGTCTCGCACCCTGGGTAGACCACCTCGACGTGCATGCTTCTGAACGT
TTTTCGCGACATACCACAGGCAAAGCAGAACGGGGACCGTCGGCAAAACAATGTCAAGCACGTTCAAGAGCGCTGTTTCGCAATCTACAAGTATGACTTG
AGGCAGAGGAATATCGTAAAAGTTCATCATATCATTCAGCTTTTCCATAGCAAAACGATAGTCGTCTAGTTTTTCTGCACGTAAGAACACCTGCGCGACA
TGAAGGGTTGTATTCATACCAGACACGCCCACTATGTCCAGCAAAGGCATCTTGAAGTAAAATTGGTCTTGTACGTGCAATCCATTTGCAAGACGTCAGG
ATGCGCTTTGAATATATCCACAGCTGGCTTAAACGCGAGGAAAAAATGACTCAACTGGTTCAATGAGTCCACCTGATACGAAGAGTAATACTGGTCCGAA
ttgagctcgtcaagcagaTACTCCATTCGCGACTTTCCTTGAAGTATATCTTTTTCAGCCTTTCTTCTAGCGTTGTAGATATCCTCCACTATGAGAGAAC
TGTTCGGATTAGCTGTAACATGGCGAGCTACGGTCTGGGCCGGTCTGGTGCCATTTCTGGCGTCTGCAACAATCTCTTTCATTAACTCAGGTGTTCTGTC
CGAACGTCGGTGAACTGGGTGGGCGGAGGCACTCTGCGATCTTTCGTGGTTGTGTGTGGTTTCGTTGCCTCGATGCTCGATTCGCCAAACATCGTTGACC
ACGTCCTTGACTAAAAAAATCCGCATCGGGCAATTACACTTTCGAGTAGCGCGTTTACGTCTACGCCTTACACCAGCTTTAGGTTTGTATGGCTTGGGCT
TCCCGTGACGGTCACAAGCGAGTTCAATAAAaatcttctccttcgctgCGTTGTCTTTCGATCGAAGGATCACCACGCCGTATCCATTTTCACGCGCAAT
TTTGTTGATCGCGTCTTGACCAAATTTGTCAGAAGTAAAGCAATCGATTGGATGATACGGAAGCGGTACACCTTCTTCGTGGGTTGGCTTCGATCCGGAG
AGACCTCAATGCGCAGCGGCTGTAAAGACGAATGAAATGAAACCCAATGGGAGCTTGGACAAGAGACATAAGCTAAATAAAAACCCTGCAATGGTGAACT
ATTTTCAAGAGCCACGGGCGTCTAAAAACAGGATCAGTATACTCTCAAGCATGAGTGTGATCGTCTTATACGCTCCAACAAAAATCTCCATAGTCACCCA
TGACTCCGCCGCAGTCTGATGATAGCTCCCGACACTTGATGCCATACAGCCTCTCGTTCAGTGCGGCTAGAGCTCGCCGTGAGTAAGCACCTCAATGTTG
CTCCGCTTGACCAACTTGAGCGTCAGAACCTCGATGTTGCTCctcttgagcaccttgagcttcagCACAGTCGTGCACGTGAGCAAGTTGGCGTCCTGCA
TCAGCGACGCTTTGGCCCGGACCGAGTCCACGTCCAGTacctgcaccagcgccatcATCTCCGTGAGCGCCAAGAGCCCACCTCCCCAGGTCTCGACGTT
GGtgatcttggccttggagCCCGGGAGAAGCAGCGTGATGCGCGCCTTCTCGTGGTCGATCATGTTGAAGGCCACACAGCTGCCGTAGACGGGCGTGGTC
AGGTGCCTAGTCCCGCACTTGATGGCTTACGGCTCCTCGTGCATCTACAGCTCGACCTCGATGATCCCGTAGGCGGTGAGCATGCCCATGGTCTTGGGGT
AGACGCCCATGGACACGAGGCGCGCTGAGCTCGGGATCCTCCTGGCGTGGTTGGTTCACGTGACGCTCACATGCTCAACGATCCGCGGCGCGTACGTCGT
GCTCTCCCCGCTTTCGTTATAGAAATGAGAAGGCAGATTAGAAATGTACCGTTTTAGTGGCACACGGGGTGGGAACAAGGAAACCGGGGGTAGGATTAAC
GACTCCCCTATACGACGTTATACAGCAGAGTTACTGGTGTAATGAGGTAGACACGCTCGATGGCAAACAGAAAAGTGAGTTCATTATTTAGGTCCTAGTC
GACTTGGTTGTGGCGGCAATTTGCACGTGCATGTTGCAATTGAACTTTCAAGTTAACTCAACTTACAAATCTCTAGAGAACCTATAATAAATCTGATTGG
TCAACGAGCTAAGTTGAATTTGTGATACACTACGCGACAGGTTAGATCGGCATTCACGCTGGGGGGTGCTTTGGTCGCTACTTCTGCCAacgctgcgctt
cagcaCTCAGTCGCTAAAATATATCGATTGACTGACTTACGGCCACCGACATGGATGGCCGATCTAACCTGTTGCGTAGTGTATGACGTCGGATACTGTA
CATCACAGGCGCCCTCTTGTGGTCATTTAATTAAAAAAAACTTTCAAATATGGTTCATGTCGCATATTTGTATATATACGTATTCATATTTGTTGCTTTT
CCAAAAAACAAATATACGTAAATTTTCAATTTCAATAAGTTTCTTGCCAATCGTCCTGCAGAGCCATGGAGCACCTGCCCGAGGGTCTGCTCGCGCACCT
CTTCTCGCTCCTCTCGGCGCGGGACGTGCTCCAGGTCGCGTCCACCTGCCGGTCGCTCTCTCCGTCCTCTCCGTGCGTCCAGCTGgcactcgagcgcgtc
gtcaCGCGTCGCTTCGGCGCCGTCACGAGCTTCCTGCCGGCCTCGTCCGACCactggccgcgctcgctcgccgtgctgcgcggggccgagatgctgcaca
tcaaggagctgctggcgcgcgcggccgcgcgGTCCTTCGAGGACGCCGCTTCATGCCCGCccagctgcgtcgtcgtgagCCGCGCGTGGCTCGGCGCCTA
CAAGAAGCGCTGCCAGAACTTCGAGCAGTttctgcagcagttccgcCGCACCAaaaggcagcagcggcggcaaaATGCCGCTAAAAAGAGGGACGTTTCC
GAGTCGGAGACGCTCAAAATGGCCGCTAATTCGtcgctggccgaggccgGGGCCATGATCGTGTGCGcccacgacgcgctgctgcccgctGCGCAATGCG
TGGGCCGCAGTCGACGCGCTATTGTCAGTGGGGACGTGTTTAGGGAGATCGCGGTCTACGCGCCGGAGCTGagaagcttcagcttgcgatcgtgcagcga
ctgcaccacgtgtgtgctggagcaggaggccagggagctggaggctgaggagaagaagcaagCGAGGTTCGACGGCGAGATTGCAGGCTccgaggagatg
ctggagctcctgcagaGGAAGAACGGGTACCCCAAAGGACTGTTCTCCCCGGTGGACTCGGTGGGCAGCAGATCGCAGCAGTTGGCCCCGCATTTGTCCG
TGAATGGACGCAGCAAGTACGCGACGTATTTCCTGGTGCCCAAAAAGTGGCTGAACAAGTGGAGAAAGTTTGTGAGAAGTCAAGCAGATGACGCGCCGGG
ACCAGTGCTGAATGCTGAGTTGGTGTGCTTGTCGCACCAGAGGACCATTGTGCCGCCGTATATCTCCATGTTTCTGTCCGGGttcacgctggagcagtcA
CTCAAGGCCACCCAAGCGTAAGTTGTGTCTGTTGGATTTGTCGACTGGTGTGGTAGGAACTCGTTATACTTACCGAGTCTTGATTGTTGCTATTTCTACA
GTCTCGGCTCGACACCAGCCCGCCAGTACGAGATCATAACGTTTGGCGAGTGGGAAGCACTCTACGATAGGTATTGCGCCGAGTTCGCTGTCGGCTTTGA
TGTCATCAACGGGGCGTATCACTGGAGGACACAGGAGTGCCAGATGTGCAATTACGGCATGGGCGGCGGGCTGTCGTCGAATCAGCCAAACTCACGGCGC
TGAATGCGGACTCCGTAAAAAGGATTGGACTATACCCAGGGACTTCCTTACTCCGTCCCCGCCGAAGTAACTAACTGGTGGTGCGTCAGGCTTCTCGTCA
AGTCTTAAATCGACCACCACTTCGCCAAGGCTCGAAGCAACGAACCAGACACACCTCCAGCACAAATATGCACATTTATTCACGTAGAGCAGTGATCTAC
AAAGCAAAAGGTACCCCTTCGACACACGGGACGACATTCACTGGTAGGTTGatcgccttcctcctcgatTTTGGGCGATGGTGGCGTatccagcgtcttc
actCTTCATCATCTTAGCACGACAGAAGGCTTCCAGCATAGCAGGCACACTGAAGTTTCTAAAGCTCAGGTGTCCGCCGTAACGCAGCTGCGTAATTGTA
CGCTTTGAACCACCGTTCCCGCACCTCTTGTTGAACTTGTTTCTTGCTCGCAAGAAACTGTGCTGTCGACTCAGTAAATATTCGTCGGGACTCTGAGATC
CCTTCGCCGACGATCATGGTCAGACCGAATACTGTCACAGCAATGCACGTTCcaaccagcaagaagctcagcaacTGCACATTGATCTGCGACTCGGCGT
TGAGATCGTTCAGCCGAATCATGACTCCAAGCCACAAGGTGAaaaagagctgcagctgcgtgatACTCGCGATGAGGTTGTCTGAGTAGCCGTCGTACGG
TTGGAAGAATAGCAGGAACCACATTGTCGTCAAACTGTTTCGTTGAAAGACATGATACCAACTTGTCAGTACTGCGTGTCCTGTTACCTACCCACTAAGC
AAATCAATCAACAACTTACCAGACGGCGAGTGCCAGCAGGACTTGCTCCACACTGCCGTTCTCCACGAACACGATCACACCACTCAGGAAAAGTTTACGT
GAAAGATCCACAACTTCAAACCACCAGTAGTCGTTGGTATCTGACGGAAAAAAAAAGAGAGTAAATGCTAGTTGTGAACGGAGGGTGCACATCGTTAGCA
GCACCTACATTCAGCGTAGATAAAGCCCAGTCGCGCTTGAACCGTAGAATCCTACGCATAAAACGTATCGTTATTCATTCTGTAAGTCAAACGACCAGGA
TGCAAACTTGTGGTAGCGTACCGTCAAGTTCTTGACCTTCATGTACTTCGCCAGCTCCTCATTTTGAATCTCAACACTGTCCATGTCTCGAACAAACCGG
CCATCTGCAatttgctgctcctccactTTCTTCAACCACTTTTGCAGTTGTGTTCGCATTGGCGTACGCAGCAACTTAATCCGCGCAACAACTCCGCGGT
CCTGTGCTAACCAGATCAGGAGACCGAAGAAAAACGGAATTCCCACCACCCAAACGATGACTCCGATCGTCGCGACCATACCAAACACTGCCCATTGTCC
GTTGTAACACACTAAACGTCGATCCGCCACGAGATAAAAGATGTCGCCAACCTCCTGGCAGTTGTAGACCGTTAGTATGGTCTTCGAGACAGACGGGTAC
AGGAAGAGAGCCATCCAGCAGTAGAGCTTCAGACACTTGTTTCGGTACGTCAGATAGTTCATGCGAAGCTTCACTCGAGCTTGCCACACTCGGAGATTAC
TGCGAATTGTGCGATCAAGCGTCACGCCAGAAAGCACGTCCCGCTTTGTAGGGCACGTAGCATGCACCGATCGAAACAAGCCGAAGTACGGAGTTCGAAC
TTGTGACATCCCAAACTTGCGCTTCAGCGACCGAGTCATCTTCAGCATTGAaagagcgagcgagctctCATCCTGGGGATCTCCATTAGACGTTTCCACG
GGACTAGCAAATAACTTGCCGTTGTAGAATTTGTgcgtccgccaccagctccgcagTAGCCGGAGTGGGTTGAAGCTTTCATCATCGTTTTGAATGACTT
CACTCTCCAGCACTGGAAGTCCACACCGCAGGCAGTTGCGTGGAATTAGCTGCAGCTTTGTGCGATAACTGCGCATACCCGCATAAAAGTACGCGGTGAT
AACCGTGAGGGCAAACACGACCAAGCTCACGGTGGCACTAACAGaaaaattaaaaaaaataaacaGGCACGAAAATCCAAGTACACAAGTCAGAAGAGTA
CCTCGAGCTAAACTCAACCAAGATAAACTTACGTGAAGTCGAAGTAGAAATTCTTTGTGACAACGCAGTCAATACCAGCGATAGCCACCAAATCCTAGTC
AATAACGTTCACATAACGTTATTTGAGCTCTGCAAATACAATAATGGCCACGTAGTTTCCCTACCAGGTTGAACTTCTGCGAGAAATTCATGATGTTTTG
GACGCTGGACGACCATTTCACGACAAATGAGCTCTGGAAGTTGCCAAATATCTGGAAGAACCCAATGATGATCTTGAACTTGCTCGGATTTACAGGAAAC
GTCCTCACCGGCGGGCGCACTTCCACTCCAAATAGTATCTTGGCGTTGCGATCCTGGTCTTTCTTGAAGAAAGCTATGCGTTTGTTCTTCACTTTGCCCT
CGCGCTCCGCCACTGCCCCAGAATTTCTCGGATCCGTAATACTCTCCTGTGAAGCAATTCCCTTCTTGGAATCATGAGCTTTCAGCCGCCTATCCGCTTC
GGCTTTCGCAAGCAGATCGATCTCTGTGAGATCGCGTAGGTAAACTCTCACACCGTAGATTCCTCCGATAAGGACAAGAAACAATAGCACCGGTATGACG
AAGTTCTGCCATCGAATCGACGCTCGAACTTCAGCATTTGCCTGATCGCATGCTACATCCAAAACATTAAACCCACAAATTTAGGAATCCCATTGTCACT
ATACAACTAGGGATAGTGCATCACTTACGCAAACACGAGCTATCCGTGGTCCGCTTGAATCCGTCGGCGCACACTGAGCAAATTGCCAAGTCGTAGCCGC
TGGCACATGATACGTTGCTCACCGTAGATGCCAGAGCAAGTGTTTGAACCGAAACATCAGCTTGGCAAGCGCCCTCCACCTATAAAAATTAACCGGACAA
AACGAAACAACTAACAACAGTAAGAACCAAGTAACACCGCCTCATCTCGAGCATCAAGGCCTTACGTCGCAGGTGTAGAAAGCTTTCCCCGACAGACACG
AGAACAGGCGGCTAGCCGACCAGTACACATTAAAATCGATGAGGGTTGAGCACTCGTATATCAAATCCGAGAGGCTTCTCGTCGGGTCTTCCAACGCAAG
TGCCTTGCACGGATCTTCCTTTTTCCATTGGGAAGGCTCAAGACAGTTCGACTTCTGCTTTGATGCCGGGGCTGAAAAGAGGTAAAAGCCTTCCTCCGTG
CGTGGGGATATGGTACCAAGCTCCTCAGCAATTGTATCCGTTGCACGTCGTACAGTCATGTTACACTTGGCTCCTGGTGGACAGTTGAAGCACTTTACGC
CGTCCAAACTGCAACAACGAACAGGAATGTTAGTTACAGATCTTTGCACCGAACCATTACAGCGTTAAGCAAATACCTGTACGTATTTGCTGAACAGCGT
TCGCACACACTGAAAAGCAGAAACAAATTACATATCAGTACCCCAAGCGTGTTGTGAATCTAGGGTGGTTTAGCTTACCCTTGGTTGACCGAGTATCCTG
GCAAGCACGGCAGTAACTTTACGGTCTGGACAAAACTCCGCGGCTCGGACCCTGGTAGTGTGCACGAAATGTCGGTGGTGTAGATGCCTTCCTCTGGGGT
TCGGTTGGCTGCAGTGAAAGTGGCTTCGCGATACGAGATgaccccagcagcagcacggaccaAAGAGCGCGGCTCAAAAAATAAGCGCTCGGTTTGTTCA
CTGCACAGACCGTCGCTCACGATACACTCCGTCTGATTGTCAAGTACTTCGATTTGCCCATATAGATCCACAGCCTTGAGTCGAGGCCACACATACATTT
CCTTTTCCAGGCTTTCGTTCCGTGTCTTGATCGCCTCAATCGACTCCTCATCGGGCTGTTCCAGTATAAGTACGCCGCTGGTTATGTTCTCAGGCCACCA
CATCACCTGGACGTCTCGCGTATTGGTTGCGATGTCGTACACTGTGTTGGATTCCATCGTGCAGGCCGTGCACGGGTCAACACGAGTACGATCTGCATCA
CTTGATATCCAAAACATACACCCTCCACTTGGCGCCGTGTTCCCTTTACAGGTGATTCCGGTCGTCGTGGCATTGTCAATCGACTGGTAATACAGCGCGC
CACCACGAGTAAAAGCTGCATTGCTAATAAACTTGGAGTCCGATATGCTCATTGTAGACCGCTCATCCGAATAAAGAGCCCCACCAAGTACGGCACTGTT
GTGAGTGAGTTCCCCTAGTTTCATCGTCAGAGTAGCTTGATCCGTAACATAAAGAGCTCCACCGTATTCGAGGGCTTGGTTGCCGTGGAAAACTACCGAC
GAGAACGTGGCCGTAGATATACCAGTCGATGCGATTGCTCCACCGACATGTGCCGCGTTGTTGTCGAACCAAGTGTGTAGAGCAATCGTGATTTTCGCCT
TGACGTCTGTCGCAATCGCTCCTCCACTTTGATCCGCAGTATTTCCGGTAAATACGGAGCTCATGATCGCTGCCGAACCACCTCGGTCAACGTGAATCGC
GCCACCAACTAGCGCAGTGTTGTTTACTAACGTACAGTTCGTGAGCTTCACAACGCCATCAACGGAAGAAAtcgctccaccaccttcgtTTTTCCCACTG
GAGGTGACCCCACCATTGCCCACAAACTGGGACTTGTACCCCGCCAAAACAGCCCCTCGCCCAACAAAACTACCTGGGTAGATGAGAACAAATAATACTT
AGTGGCTCGACCGAGTTTTGTTTTAGAGGGGCAAGGCATTTCGTACCGCATCCTTCCCCGTGAGCAAAATTGCGCTCTACTACGGACCCATTCAGGGTGA
CGGCATTTTTCTCGCCCGTGTCGATAAAGATTCCTCCCCCCGAGTCGTCGGCAAAGTTGTCGGATATGGCTGAGCTCTCAGCATAAACTTTCGACGAAGT
CTCTACAAAGATCCCGCCTCCGGACGTCTTGGACTCTGGTAGTGCAGCAAACGGTCAGTAAACTAAAGTCACATCACAAGAATCCGTACAGTAAGTATTC
AAGAGACGCACCGCTACGTATCACTTTGACGGAGACGAAATATGCTTGGGCGCTGTTCGATAAGCACACGCTACCCCCGCGTTCGTTTGCCTTGTTGGAA
CTGAGTTCGGAGTCTGCGCTATAGAAATACGCGTTAAGGTTGATGTAGattcctcctccagcgtctgctgaTCCGTAAGTCGCGAACGACGAGAGCAGTT
TAAAGACCGAGTCTTTGTCCGAGAGGTAGACGAGATCTCCCTTTTGAGCGTCCATCTTGTGTTGGGCTCGGCTTTCAACGTATCTGAAGCCAACAAGGTT
TTCAAAAAGGACTGACCACTTATCCGTGAAAAATCTGCCCGCGTCGCGAGTAATGTAAGCTTCAACAAGACTAATCTTGGAGGCTTTAATACCAGCGATG
GAGCCTCCGATCGGTGCGTCGTTCGACAAGAACAACCACGAGTCTGCCATGACGCTAGACGGTGCATCTGGGCTGGTACGTTTATCTGCGTGGAGTCCGC
CACCCATACCTGACTCACTGTTCCCTGCGTGgttctccaccaccagtAAGACTGAGCTGTTCACGTAAACCCCATAGAGGGAAATCGCCCCGCCAGAAAT
TCTTGCAGAGTTGTTGTAAAATACACAACTAAAGAGGTCGACTTCAAGGAAGAACGCCGAGCTTTCTGCCCATAGACCACCGCCCCGATCGCTTGCATCG
TTTCCCACGACAGCCACGTTTTCAATAATTGTCATCGCAGCATCGCTAACCGCAATTCCTCCCCCATTTACCGCGGAGTTGTTAGCAATGAGAGAGTCTG
AAATCCTTGCGCTGCCACGACCCATAACGAACACGCCGGCGCCTTGTCCAACCTCTAGTTTGGCACCGGAAATGACCAACCCGGATAGCGTACAGTTGCT
GGCGCAATCAAGCACGACGTTCGCGCCATTGCCACCCTTCGGATCGACAACATTCGCCTGGATACGCGATCTCTGGTCCGCGGCGTCACCCCACAATAAA
AAACTTGCTGGTCGTAGCGCACTAATCAGGTACACGCCACCTGCTGTTGGGGCGGCGTTATTGACGATTTCCAAGTTCGAGTGATATACGGTAGCGTCAA
GAAGCATTAGCCCACCCCCGGATTGTCCAGCTTTGTTGTTAGCTACCCTGGCGTCTCGAAACACACAATTTGCGCCTGACCCGAAGTAAAGACCACCTCC
CAacctcgctgctgtcgagtAGGAAATATCTGCATTCAGCACAACACATGACGTGGCATTGAACGCGGCTAGTCCACCCCCAAATGGTGCGTTGCCGTAG
GTAACTACGACGTCGCTGACAGTTGTTCCTTCCCCGTCAATAAAGATACTGCCTCCATACTCGTCTGCCCGGTTTTGGGTCAGTGACGCTGCATTATCTG
TACTCTCTTCGGTCGGATATTGGTAGAACGTTGATGAGTTTGCATAAACGCCTCCACCACGGAAAGATACGCAGTTCTCGACGGTCAATGCGTAGTGCTT
CACATCGGCGTCCATGATCGAAATCCCCCCTCCGACACCCTGGGAAACAGAACAAGAGCGGATCGAAGAGGATTTCAGTGATAGAACTCCAGTCTCAGCT
GATAGACCACCGCCTCTCTTCGAGGCCGTATTTGAGGTGATTGTAGCTCCTTCCAGTGAGGAGACACCAGCAGTAGCAACTCCAcctcctcgttctccag
TATTCATGCTCACAGAAATGGAACCCGAAATACTCGAATCGTTAACATAGACTCCGCCACCAACCTCAGCAACGTTGTTAGTCACTATCACTGAAGTTGC
CTGGAGCGTAGACAACTGGGCATACAGCCCCCCACCGCTTTTAGTTGCCTTGTTGGTGCCAATTTTGACCGATTTCATTGTCGTAGACGAAGCCTTTTGA
GCAACCACCCCACCCCCAAGAGGGGCTGAGCAATTCTGCACCTCGAAAAATTGGATTGAGCTCTGGGTTCCAGTGATAAACAGGcctcccgctgctgcaa
cagcttGACTATCTCGAATAACTGATGCCACATCATTCGCTCCAACGACGGAGCTTGAGTCGATATACATCCCACCTCCACTTGCTGCGGTACACTCTTG
AATCGAAGCATGTAACAGTGATATCTTACTCCCAGCACCAGCGTACACCCCACCGCCTGCAGGTGCATCACAATTTTCGAGCACAGGGCTAGTTAACGTT
GCGGAGCTGTGAGAAAACGCAGCGCAGCCCCCTGAATCCGTAGCTGAGGAAGAGGTCACAGTAAGTCGATTTACTATTGAGCGCGTCCAGTCGCTGGCAT
AAAATCCGCCGCCAGAAGCTAATGATAAAACACCCAAAATGTTAGTCCTTCAACGACGGTGTTAGATCATAGGCTCAATCTACGTACCAGCCGTGCAGTT
GAATATCTCGGATGCCACACTATTCTCAAAGGTTCCGTTGGACGCCATAAAAATTCCTCCTCCATTGCGATGAGCATGATTTGTACTCATCGGCGAGTTT
TGTAGATTCAGACTTGCAGCATTTAGTAGCGCAATACCTCCACCATCGTTGTCCGCACGATTTCCGACGATATTCACGTGCAAAAGCGTTGAGCTTCCAC
TCGTTGCTGTTAGCCCAGCCCCTACCAACGCAGTATTCGCGAGAAGGTTTAGAGTCGTGCCAGTGAATGTTCCAGCGATGCAAATTCCACCGCCATTGAC
GTCAGCATCGTTCTGCCACAACTTGCTGTCCTTGTCGCCGGTAACCGCAACAATGTTTTGCGCATATATGCCACCCCCTTGGCTTGCGGAGGATAACTTG
ATGGTCGAATGGTCAAGAACCAGATCCGACCCGTCCAAGAACACGGCGCCACCTTTCCCGACTGCGGAGCAGTTCGTAAGCTCCGAATTGGTAAGGGTTA
ACTTTGCCTGGTACGCGTAAATGGCGCCTCCATTTTGGAGAGAATTCCCATTTGTGATGACGATGCTCTTCATCAGAACAATTGCACCCGAGGCGCTAAt
tgcaccaccgccagcacttgCTAACGCATTTTGAAACGTGATTCCTTCCAGCCCGACTGACACGGCGTCACTAATAATAATCAACCCACGGTGTATGTTT
TTGCAGTCCATAGTTGTCACTACTGGGCCTCTCAATCCTCGAATGAGAAGGCTAGGAGTTGCCACAATCAAACCACAGTTGTCAACCCCGCTATAGATGC
CTGGATAGAGTAAAATCGTTTGTCCGGATGTGGCAAGCTCCAGAGCGCGTCGAAGCGATTTAACAGCTTTTGGGTCTGTTCCGCTAGCTGAAGTGTCCAT
ACGCTGCCCTGTTCCTTGTTCATCATCGCCGTTTTCGCTCACCACAATCACGTCATTCTGGGACTTGAGGCATACGGGGTCACACGTCGACGGTGTACAT
GTCGTCGGATCTTTCGGACAGAGAACTGCATTGGTGCAGCTTTCCCCCACGTAGCTACTGAAACATGAGCAAGAACCTTTTCGACAAGCGCCATTCAGTG
AACAAAACCCGTTGGAGGAGAGTGGACACGGGGCTGAAACAACTTCTACTGCATCCGACTCGTCAACGGTCTCGTAATGCAGAGCCATTCCATCGTAAGC
CACGGTGCCATCCGACACGAACGCGAGCGTCACACTATCGATCCCGGGGGCAGTCGACACAAGAAAATTTCCTTCACGGCGGCATCCTCCCTTCCACAGC
TGCCTCGTCACCCCACTCTTTGTCACACTGATAGTTAAACTGTCATGGTCGCACTCCAGCCAAAACATAGAGAACTACATCCCGAAAAAAAAAGTTAGAT
TTTTGTGCGCTCACATCGCCTACAGAGAAGAAAATATCCAGACTTACGCTGATCAAAATGCCCGTTTGATTCGGTGGCGTGATTGTCCAAGTCTCGTGAT
CAGAGTTTTTGTAGTCGTGCCAGTGGATGTGTCCTTTGTTGCCGACGCAATCGAAACCATTTGATACCGGCGTCGTGGCGAGGAACGTCGTCGCTTCACT
TAGCTCACTGGTAGATCCATCCGTCCTTTTAACTCGCACTTGGTACACATACGTTGTGCCCACCACGATTTCGTCCTCGTACGTGATATCTTCCCCGTTG
TCATGATAGAATGCGTTATCCCGGTAAAGAAGATAGCTGACCGCATCATCCTCAGTCTCCCAAAACACATTAGCCACCGTACGTGAATCTACAAAAAATG
CATCAGTAATCGTCAAAGTTACAGATAACAAcacaaaaacaaaacaattAAAGCAGAGCACAGTCTTACGGCAGCCAACTGCTGGCGGTCGAGGCTGATG
AGCATAGAGCGGTGTCCGGAAGAAGACAACTTTGCTGACTTCACCTAGTTCGCCAGCGCCTGTGACCGCTCGCTGGAAACACACGTCACATAGCGGGAGT
TAGTGTACGCACTACGACATTAGCATGGCGAGTACGTACCACCGTGGCAGAATAATCCGTCTTAGGGGTCAACTCGTAGATAGTAAGAAGCTGTTCAGCG
ATTGGGATTCGACCGGAGAACGTAATACTGGTGTCCAAGGTCTGTACAACATCCACTCTGTAGGTGTCAACGTAGCCACCGCCAAAATCGATACAAGGGT
CCCAGTGCATAGTAACGAAAGTATTGGACAGCTCGGCGACGTGAGCATCTTGAGGAGCAAGAGGACGCGACGTTTTCTCCGTGTTAAACGCAGCGACAGC
GCTAGGCGGAGACACACCCACGGGGTTGAAAGCGACGAGAGTCACCGTGTACTCCGTAATCGAGAACAAGCTTCCGATAGTGCATGATGTAATCATCCCT
TCGCAATGCCCGACTTCTTTGCCCAACCTCGTCATGCTAAGCCGGTAAGAAATCAACGGAACCCCGCCAGTGTCGACAGGGTCCGTCCAGGATACCGTAA
TCGCACCTCCAGTTCTCGATGTTGCTGTCAGGGGCTCTGGGGCGCCCGGTACTGTAGCAACTGATGTTGCTGTGTCCGCTCCATTAGTGGTGTCGCTATC
TCCAACATCATTTGATATCTGAATGGTAAAAGAGTACGTTGTAGATGGGAGTAGCCCTCCAGCTAGAAGAGAAATATAGGTTCCGTCATCTGCAACGAGC
TCCCTGGACATGAGACGACGCGTCTTAGGAAGTGACGCGGATGTTGTTTGCAATCGACGCACAGCGTCCGCTGGGATTTTCACTCCATTTGCATAAACAT
TCCACACTAGATCGTCCACTTTGACTCCTCCTGTGTCGTTCGGAACCCGGATAGTTAGCGTAGCAGAACCTCCGGTGGATCGGAGGACTACCGGATCACC
AGGTAGCGACGGTGGCGTGGCTGAAGTGGTTGAAAAGCTTTTCACGCCAGGATCGGACCCGGTTCCGAGGCTGTTAACGGCAAACACTTTGAATTCGTAC
GTTCGGTCGGCCAGTAGCCCGCCAAAGCTTATGTTGGGTGCAATTGTCTCCTGTACCAGTTCAGGATCGCCACTTGAATCCTTTGCGTGTACTGAGTAAT
AGGTGATTGGGcttcctccgtcgtcgtcggtaCCCTTCCACGAGAATTGTACCATCCCACCCGTTGCGGCGAAAAAGGTCAAGTCACTTGGTGGACCTGG
TGCCGAGATGAGGGTTGTTCGTAGCGAGAAAATGGACGAATTACTGGAATATCCAACATCGTTCATGCAAGATGCCATGAACCGATACTCGGTCACTTTT
TCCAGCTTCGTTTGCCAGTAGCTGCTCTCTCCGCCGTCGTAAACCCGCGTCCAACTCGGCGTTGACCTGATTGGACTCATATACACCTGGTAGGACAGAT
CTTGGGCACTGCCCCTGTCGTTTGGAGGCTTTATTTCCACGTGAATCCCGCCACCGGTGACACCTGTTGATCGTATCAGCTGGATTGGCATTGGCTTTGA
CGCCACGTCGGTCGTGTATACGACTGGTTGAGGACGACCTTCGTCGACGCCAGGACACGCTGACGCGTCGTTCAGTGGGATGTAGTGAAAGCTGTAATTG
GTTTCGGGTGTCAATCCTCCAATCTCCACCGTCACTTTAAGATCGAAGTCCCCTTGCGATTTGTAGTTGTATAACGTTCCTTCCACCTACAAAATCACCA
CCGTTAAGGATAGCCCGAGATCGGTTTTAAAGCATGTTTTGTTGTTTTGCAAGCATCGTACCGTTTTGTTGTCAATATAAAATTCGTATCCTGTTATAGG
CATTCCGCCTGATGTCGATACGATCAGCAAATGTGTTAGTTTCTAGTTTCTACACGCTGCCGAAAATGTGTTGATGTAATGCACGTACCAGTATCATCTG
GCCAGGAAATGCGCACATGAAGCGCACCTCCGGTTGAATAGTCGAGATCGGATTCTGGGGGCATTCCAGGTCTCGTAGGAGCCACAGTGCTGAAATTTGC
CACTTCACTCAAGTTCCCGCGCACAAAcacgtcgtactcgtcgccgTTTTGCAAATTGGTGGTAGCTATAACTCCGTCGTCGACACTGAACGACGTGGAA
TATGCGATCGTGTTGTTGGATTGAATTTGCGTTGAGTCCACCTCAAATATGTATCCCTGCGATGGATTGTAAAGTAAGACACGCGATCGTTAGATTGAAT
CGCACTCAAAAGGAACGAGTAGAAAACAACACTTACGCCGAACTCTAAGTACCCGCTCTTCAGGAGCGCAGTTGTCACATTGTCCGAGAGCGTGATGCTC
GACTCGGAGATAGAAATTTTGCCCCAAGTGAGGGCGCTTGCGATGTCGTCGAGAACGGATACGGCCACCATTTCGTACATAGTATCCGCTCCTAAGCGAA
AAATCGAGACCTTGAGGCCTTCCACTACGTAGTAAGCCTGACGAAATCTCTTGCCCAGCCCTTTCTCCCGGTAGTAGATCATGTATGAAATGTTTTGATG
CCCACCTGTTTCAAAAACGAGCATCTAAGTGTACAGTAGAACCCCTAAAACAGCGCCACTATTTCAGAGTGGACATACCTGTGTCGAGGGGAGGTTTAAG
ATCCAACGCTATGGCTCCACCTGTACGAGAGGTGTGTATAGAGGGGAGTCGAGGTGGTCCAGGACGTGACAACGGTCCACTCTCAAATCTAAACGGCTCG
GACAAATCCCCAGCTCCGACAAAGTTGACAACCTGATCGACTCGGTTAGTTATGAAACACTGACGTATCCTGATCAAACAATGTTAAAAAAACTCAAACC
AACCTGTGCGCGTATCGTATACGCAGTGTTCGACTTGGCCACGCTAACTGGAATCACTGCTGCTTGATACCCTATGCCATTATAAGCCATCTACACGAAC
AGCCAAGAGCATGTTAGATCCTGATTCGCCACAAATACCAGTTTTGATTCCTCTCAAGCAAGCAAACCTTGTAATCaccgctgccttcttctgccAGATA
CAACACGTATCCAATTACAGGGGCTCCTCCAATATCCGTCGGAGTTGCAATCGAGACCGTGAGTAAACCTCCCGTGCGATTGAGTAAAGAAATGAGTTCG
GTTGGCCCTGGAGCCGTAAAGTTCGTCGTCCAAAATGTGGCCTTAGAGCTATCCGTGCCACGCCCGATGACGTTGGTAGCCGAGATGGTGAAGAAATATT
CGGTAAGCACCTTCAATCCCCCAACCGGCAAAATCGTAGCGTTTGTCGGTGTGACTATCCATTTTGCAGTGTTGGCGGTTCGAATAGAAATGTTGTATCC
AGTAATCCAGAGATCCTGACCACCGACATTAACAGGGGTCTCccacttgagcttgagcagccCACCCGTTGCTTTGTCAAGCGTTGGTGCTTTCATGATT
CCAGGCACAGAGCGGTCACCGTCATCCTGTACCACAACTTTCATCACGCTGTAGGCTCCAACCTTTGCCGCTCCCGCCGCAATTTCCAGCGTGAGGTAGA
AATACAGATATGGGAAATCGTAGACATCATTGTCCTTGATCACAATACTAGCAGATGAGGATACTTGGCCATCAATGAAGTCGACAGTGGCTGATGGTAG
TCGAAACCCAATCTCCGGTTGCGTTGTACTGGGGAGACTAGTGGCTACAACGACACGGACACTAGTTGCTGTGCTCTTTCCGTTCACTCGATCCAGTTGA
AGACTCAATATTCGAGCATTCTCCAGCACTGAAACCTCACTGGAAGCAAATCCAATCGTACCAGCATCTCCATCATCTACAATGGTGATTAGGATCGGTG
TCGGCGGAAATGGATCACTACGATCAGGAGTTGTGTCAGTGAGAGTTAGGCCGATCGTCCTTGGGTTCGGCTCGTACAGATCGTTGTTAAGAATATGCAC
ATCAAAACTTTTTACTATCCCCTCCCCAACAAACGTGAACGATCGATCGGACTCGGGTGGTAAAGTATAGTCTCCACCATACACAGCAGTGCCTGAACCA
TCCGAATATCTACAAGTGATCGTACTTGACGAACCATTGACGCGGAGCAGCTGTACAGTCACTGTCGAGACGTTCTCAAACACAGTCGACGATACCAGGC
TGTACGTGATGACGCCCCGTTGCGTCACGTCTGTTTCAGCAGCCAGATCAGGTGTCGACTCGCTGGTCCCTGCGGAATTTCGAGTACGCACCCGGAACGA
GTAAATGTCTCCCGGAATCAGTTTCGGGATCTCGACTGTCGTAGTATTGCTCTCCGTTTGACCACTTTCGGACTTGTTCATATTTGTATATGCTATCTCG
TAGCCGATAtcgtctcctccagcatcgtCCGGTGCGTCCCATTCCAGAAACACCGAAAACGACGTTCGGAGCGTCACATGAAGGTTTCTTGGTACCGACG
GAAGTGTTGCAGGACCCATCACGACTTTCACGGCATCACTACGAGCACCTTCGCCAATTGTCTCCACTGAAGAGATAGCGGCCACCGAGTAGTAGAAAGT
AGAACCCGCGTGTAAGGGACCGATCTCAACTAGTGTAGAGCGCGTCGCTGTGTCTCCGAGTTGTGTTTGATTATTTGAGTCCACTGAACAAATTTTCAGT
CCATTTTGGTACAAGTTTAACCCCGTAATCGGTGTTCCGCCATCATCAATGGGGAAATACAACGTCAGTATGATCATCCAGTGCTGTAATCCAGTCGCTT
CAAAATACTGttcaggcgctggaggtgctgtAGAAGCAAGAGCGGCTCGAGTTGCCACAATTTGGCTTGTTGCTGAGCTTTCTCCGATCTCATTTTCAGA
AGTCAATAGAACGGTGTATGCCGTGTTTGCTCTCAGACCGTAGAGCACATAGGACGATTGGGTTCTGGGTGTAGTTCGAACCAGCACAATGCTCGTATCA
AGAGCCACCTGCAGACGGAATAAATTCAACGGAATGCCACCAGAGTTTGTGGAAGGTGTCCAGGCCACCGTAAGGTTTCCACCTTGTGCGACAACATCTA
GTCGGGTTGGGGGGCTTGGAACGGTTGCACTAGCTGTAGAAGCAACAAAGGTCTCGCTCGTGGCACCGAGTCCAATCGAGTTCGTCGCGCGTACAGTGTA
AACGTACTCTTGCAGTGCAGTAAGCCCCTCGTCATCTAGATAAACCACTGTGGCACTAACCGCTGCGATATCAgctctccagctgctgtTACGATAAAGC
TTGTAACCCGAAATTGTG