Description :
From Genome Similarity Track
Location :
Scaffold_281:29453- 30953
Transcript NameFunction/comments
Phyke_g7900hypothetical protein PHYSODRAFT_347033

Sequence
1500 bases(100 bases per row)
TTCAGCACTTTTCCACATGCGCATCTTTTCCTCCAGACACGGAAGGTGATAGCAATGGCCGCACTCAAACACGCACGCGTGAACGGTCTCCATACCAGAT
GACggcgcacgcagcagctcgctgCAGATTGCGCacgccttcttggcagccacaCGTCGCCCACGCTTATGTGCTTCTACCTGccgatggagaagctcga
CACGGTCGTTATCAAACACCTTGCGTGAACCTATGCACAAGTTTTGctggcggcaagaagaatCGAGACGTCAGATCAACCTGCTTAGGAACATTCATCG
CCACGTATCGCCACGTGTACATACCTGAACGCGATAGTTGGCAATAATTGCGATCAGCTTTTGTTTGAGATTTTCGATCTCCATGTCATCAGGTATCTGC
CGAGCAAATACGATAATGTCAGGGTTTGTCGGGGTTGCTAGCCAGGAAATACAAAAGGGAACTATCCATACAAGCTGCGTACCTTGCGAATGAGCTTGAT
GGGGTCAATCTTGTGTTGCGAGGCGAACTTCAGTAATTTCTCCACGTTGTCCTTGCTAGTGAGGCTCAGGTCAATAAGATAATCCCACAGACCCTCGTCG
TGTTCCTGCACGAACTGAATGGCCTGGTTGATGTCGCCGCGTTGCGTTAAAATGAGGTCGAGCGCCTTCTTGTGTTGACCCATGCGCCCTAAGATGTAGA
TCATCGTATCCCACAATGGAGGGGTATGCTCACTGCAGTACTTGTAAGCCTATTGGAAACAATGCAACACATCACGAATTTAGTACACGCCTCAGATATT
AGACAGTCGTGATAAATAACAGGAGAGTTGGCCGCTTACCTTCTCTAGCGGTACAAAGTTGCTAGTTTGCAGAAACTTGAGCAGGAAATCTGGTGCGAAT
TCGGCATATAGCGCGACTTGTTTCTCGTGCAACGCTGAATAAATCTCCGAGTTGTACTCACCCAAACGGTGGAGAACGAGCTCGTGTAAGTAGGCGTGCA
GTAACTCGGGTTCACCCTCAAGCTGTGTGACAATATCGCTGATCTTAAGCTGTTCCGTTTGGTTTACAAGCATGCGAACCGCGATAGGCTTGTCGATGCG
CATCAAATTGACCACTTTGTTGGCGACGAGCGACCACAACTGATGTTCAGTGATCAGCTTGAAGGCAAAATCCTTGTTGGTGCAAAATGCGCCTTGGGTC
AAATAAATTCGCAGAGCGTGGTCATACTGCTCCGTGGCTGTGTACAGCTCCGCAAGAGCCTCCATCAGGTACATTGTTTCAACGCTCAAACGGTCTGCAT
CAGCCTCAGCAATACGTCGGCGCCGCACAACCGTCTCTAGTTGATTAATCCATGCCTGTGCGTCATATAGCGGCTCGAACACATGCGTCGTCTCTGTGTA
TTCTGGAGCTACGGGCGATGCGTTGCCATCCTCAACTTCAGACTGTTGCTTCGCAACCGGAGCATCTTGGCGTCTGGGTTTGGGCCATTTGCGGATAAGT