Description :
From Genome Similarity Track
Location :
Scaffold_2:2945229- 2946874
Sequence
1645 bases(100 bases per row)
TAATAACTGTATAAAATGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTTTTAGCCAATCAGCGACATGCATAGCGTTAGAATTCTGC
CAACCAGCCGTTGGCAGATTCCCAGTTTAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAATCATTATTTGAATCGTTTATTTAGATTAATCTATACT
CGGAGGCCCGAGTATAATTAACGCTAATTTGAACTGAGCTACGCTTCCTCACGTACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCA
TTACACCTGGTAGCACTTAGTAGTTCGTCCAACGACCAACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACGGA
GGTGTCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCA
ACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACATGGGGTTGCTCTGGAATTCATCATGAAGGAGCAGCGGG
ATACTGCTTCGTCTACCACGGTGTCGTCGGGGATGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTAAGCAATTACGTTGGAAGAGAGGGCGAGCCTCT
CCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGT
GAATGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCCCAGACAAGCGTTTGAGCCCCCGC
AAAACGAGTTCCGGTCGAGGGCCGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACAT
CGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACGTATCTCTTCCGTGAGTACCCGAGT
ACTCTCGAAGCTGCAATCACTCTTGCAATGCAGAAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGCGCCGAGGCCACAGCCTCGCCCGATAG
TGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGCGCTGCAACTGCTGGACCCCAGCAGTCGCAAGGAAACAATGTGCGATGCTACCGATGCGGTAG
AATTGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCGAGGCACCGTCGCAACCAAACAAAAAACGCTGGA
CGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTCAGGACTGCAGCCCCCAGTGAGGTTTATTCTCA
CTGCAAGATCCAAGATGACAAGCCTGACCTTGTCATCCTGAGCGTGAACTCGATGAGAGCAACCGGCTCTCTTCGTGATTTGGTAGACTCTGGCGCGTCG
AAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAG