Description :
From Genome Similarity Track
Location :
Scaffold_1189:2945- 7762
Transcript NameFunction/comments
Phypl_g12705hypothetical protein
Phypl_g12706hypothetical protein

Sequence
4817 bases(100 bases per row)
CGGCGATCTCACGCTGGCAATCGCTGGAAGAACGTCTTGCAGATATTGATCCAGGCGACGATCGAGGGCTGGTGTGATCTGGATCTTCTGCTGGATCATT
TCCTCATGCATTTCCCGAAGAAAACGGACGATGTCGTCTCGTATCCAGGGATCGAAGCGCGTCGGGCGAACCTCGCCGATCCGCAGCTGCAACGCGTCTA
GCCGACCAGTCTGGTTGAAGCTCTAGTCGAGTGCGACGCGGCTGACCCATGGCGCAATCACTACCGCACTCGCCCCGATGATCATCCCGCGCGTAATCTG
ACTCGAatcgtggacaagttctTCGGCGTCCGAGCCGCGTCCGCACCAACCGAGTGAGTCTGGATTGCGATCTGGTTCAAGTGAGATCTGATGGCCCGTG
GATACGTAGTCAGCAGCAATTTTGTCTTCGTCAGATCTCGTGACGTAACTTCATCATCAATATATCTTTTTCACGTAATCGTTTGTCACCTTTTGATCTT
CCACAATCCCTCTCTCTTCCTCTGGCGATCCTGCATCCATGTTCACACTAGGCGGTCTGCGGAGCGAGAAACCCTTCAGTCCTGTGATCTAGCGGCCCCA
CCGCCTGATCGTCACATATGCATAACATGTAGCCCCTCCTTCGTTACCTGCAGCCTCCCTGCAAGTCCTTCAACCCTTTCTCAGTCAACATGGCCAACCC
ACATCGCCGGATCGCCGCCTCACTACTCCTCGTGAGACTGCATCACGCTGAAACGGTTGTGATTCGCGCGATCCCGCAGTAACTCATGCAAAGCACCACA
ATTGAAATCTGCTTCATCAACCCAGCTTGGATCGTCATACCCTCGCCTGTGCACCAGAAACTCGCGGTAGATCCGACCATATCTCGTCCTCTTGCCAGTC
CTCATGTCTGtgaccttctccacctcgtacTCGTCTGCTTCTAGATCCGGGATCCAGCTATCCTCAGGTAACAACACCTCGTCAAAGTCCAAGCGATCTG
TCTCTTCCACCGCCAATCGGATCTGCGGCCGATCGGGGAAGGCTctcacgagcttcagcttggagACGTGTACGACTGGGATTATCCGGTACTCTAATCC
CGCGATCTCGAGTTTCACCGCATACTCACTGACCTTCTCTGCCACGCGGAAGGGACCGTGTCACAGGTGAGCTAGTTTCCGAGCATAGCCACTTTTACTC
GATCCGAATAGAGCCACACACGAGATCCAACTTCTTTTTGGTGTGGCTAGATCTCCTCGTTGTGTCGATCTGCCCGTCCGGCGATCGCCTCTCGCAGACG
CTGATTGACCTGCTCACGGGCTTGCTGATAATATCGCTGGATCTGGTAACGCCATCGCCGTGGATCTCGATGTGTCCGTCGCGTACTTCCAACCGGGATC
GTAGCTTCGAGAGTGGATCTCGGATCCCACTCGTGCACCAAGTAGAACGGGGTGTCGCCGCGGATCCTATCCTGCGCCGTGTTGATTGGAAAGGTAAGTC
GCTCGGCATACTCGTCCCAGTCTCGTTGATCTAGATCCTGGATATACATCTTCAGCGCCCTGGTGATAGTCTGCACCATGCGTTCCGCTGTTCCGTTAGC
CTGTGGTCGATACGCCATCGTTGCCCGCTGGCGTTGACCCAAGATCTTATTGAACGCGCGGAATAAATCAGACATAAAACCAGGCTCGCGATCATGTCGG
GCCGCCTCGCTCGCTCCAAATCATCGGAAGACACACTCTCCATAAGATTCCGCAATTGTCTGGGCTGTCCTGGACGAGCTATCCTTCGCGATCACGTACC
CGGTGAAGAGGTCCACCCAGATCAACAACTCAGTATTGCCTTTATAAGACTTCGGTAACGAGGGAATGGGATCCATCGCGATGATCTGGAACGGGTACGT
CGCTTGGATGTTTCCTGGCGCCTCTCCTTGGATCCGTGGTCCCCCTTGCCGGTCTCACAGTCGACACATTATCCCACGCACTACTGCACGCTTCGATAGA
GACCTCTCCAGTGATGTGATCCCGGATCCGCTGATAGGTACGGCCAATCCCTTGGTGCCCTCCTTCCAGACTCGCGTGATAATGATGTAGAATGTATCGA
TGTAACGTctcaagtgcagcgagccTCATCAGTCCGTCGCGATCTGCATCAGAACATTTCGTAGGCGAGCAATAGAAAAGTAGATCATTTAGATCCACTT
CATAATCCACCGCAACGTTGCTATAGGATCtagcttcttcttgcgtTAGATCGCATACGTCACCCGCCAAATACTTCTTCAACCCTGAGATCCGCGCCTC
CTCATCCGGATTTGTTCCACCCGGAGATTCCTAACGAACTCTTCCTGCAGGACATTTGGGCTGGATATCGATCGAGTGTCGGATCTAGTCATCACTGGCG
CGATCCGGGCCACTAGATCTTCAGATCGAGTGATGAGCACTTCATCTAGGCGGTTCAGCGTAATCAGATCTTGTCACTcagcttcgtcctcgaccACAAT
CCGGCTTCTCGgtcgagcgccgcgctggccaaACTGTCTGCACTACCATTCCTGTCTCTCTTCACATGCACCAAGTCGTAATCGGGCCACTTCCTCAGCC
TTTCCAGTACCTTCTGCTTCAATAATACCAACCCCGGGGCCTTGCAATCGATCTCTCCACGGACCTGGCGGACCACCAAGTTCGAGTCTCCGCAGATCAC
GAGTCGTTTTCGGCCTACACCTTCCAGTAGGTCCAGAGACAGCAAGAGTTCATGGTACTCTGCCTCATTGACCGCCATGCTCGTTGCATAACCCGATCTG
GCCTTTACTACCGTCCATCCAGGAAGGCGCCACAAGATCACACTGTAtgcacctcctcctcgtttGACACGGGCCGATCCGTCAAAACTTACAACGTAAA
GCTCTTCGTCGGCCCGCACGGTAGGAACAGGCGCCTGGATCTGGCGTTTCGGCTCCTCCTTCGGCGCGATCGAGATCAGGGCCTTGTCGACCTCGGATCT
GGGCGTTATTCTAGCGGCAAGCGCCCCTAGGATCTCGTCCTGTCCCTTCGAACACTTCGCGATATCGAGCGTCCATGGCGACAATAAGGCAGCCCACTGT
CCCAACCGGCCTTGGAGTCCAGCAGAACGGAACAGCCAGGCCAACGTTGAATATCGGGTCAGGATCCGGATCGAACGTCTAACCAACATATTGTAGTTGA
TATCTAGGACCcgcaacagcgccagcacttCCTTTTCCACGATTCCGTATTTGAGTTTGTTCGACTTGAGTGTTCGGCTGACGAAAGTCACGAGGTAATA
CATCTTCTCATACTCCTGCATCAATGCCGCTGAGATCGCCCATTCGTTCGCATACACCACTACTACGGTCTCTCGATCCGGATCGAAATAGCGTAAGATC
GGTGTCGTAGCtaccttctccttcagcttcgaaAATGCCCGGTGGGCATGGATCCAACGTGGATTGATACCACCAGTGGTCAACATCACTAGATCCATCG
TTTCCTGTTTAACAGTCATTAGATCCGTGGATCCAGAATCGGGATCCGACTTGTCCGGATCCGATTTCCCGAGATCGATAGGATCTGACCCGGGATCGCG
ATCCGACTTGTCTGGATCCGACTTCTCAAGATCGAGGAACTCTTTCAGCTAGCCACGGGATCCTGTCATGGACATCGCAGCGAAGTCCACTTCTCGCAAC
TCGTACAGTACTGCAGCATAAACTGCGTAATCTTCGATGAATTGACTGTAGTAATTCAGACTACCCAGGAACGACTGCATGGCTCGGAGCGATCCCGGGA
AAGCCAAATCCGTCAGGGCTGACAGATCCTTGGGGTTCGTCTTCAATTCGGCTTTCGATAGTCGATGTCCTAGATAGTCCACCTTGCTCATTCCCCAGAA
GCTCTTCACAACACTGATCGACAGGTTCCACTTGTCGCACGCTTCCAGCAAGTCTTCCACTCGATCACACAATTGATCCCACGATCTCGCCGGGATCAGG
ATATCATCAATGTAAGATCGGCGCCCCAGGACCGACGGTTTGCCTAAATCCTCTGGTTCTCCACCTTCAAACAGATCAACCTGCCTTTCGTCTTGCCCAT
ATCGCGAGATCCGGGTAAACCCGTACAAGGCATTGTCGACCAGTCTCTGGTAGATCTGCGGAGCGTTCTTGAGGCCGAAAGGCATCCGATTCCACTCGAA
CAAACCAAACGGGGTGATGAAAGCCGAGATCGAACAAGCTCGATCCGTCATCGTCACCACCCAGAACCCACTCGCCATATCCAGCGAATAGTCTTGTCGA
GATCCTCCAGCAGATCATTGATCAGCGGCATCGGGCAGACCATCAATGGAGTTAGGCCATTCACCAATCGATAATCAATACACAGTCGTATGTCGACACC
ATTCTTCTTGATGATGATAACGATCGGCGATGCCCATGAAGAGGTCGAGTGGCGGATGGTCTTGGCTCGTAGCAGTCCCTTGATCAGATCCGACAGTTTC
TCGCGAAACTGTGGAGCTACCTTGCGCACTCGCTGGGCGATCGGTTTCGCGTTGCCCACATCGATGTCACAGACAACACCCCTTGCCGCGGGCGGCAATG
CGTTGCCCTTACCGATGAGGAGGTGCTTGTATCGCCAGATCTTCCGATGTAGATGGCCGATCTCAGCTGGCGAGTTGTCCGACGGATCTCCCACTTGAAT
GTCTTCGATCGTTACCTCGTCGGTTGTTGAGGCGACCTCTGGCAGCACCGCCAACTCGTCTCGGACGTCTTCTGCGTGCAGACCACCCCCTTCGTGGTAA
CATACCTGCTCATCCTC