Description :
From Genome Similarity Track
Location :
Scaffold_11:294401- 297150
Sequence
2749 bases(100 bases per row)
AAGAACACTGTTGCTCATCGTCACATCAAACTCGACTTGGCAATCACTACGTCGGGCTACCGCTCTCACTCCGCCTGATTAATTGAGGCTATCGCCCTTT
GCATTTAGCTTCCTATAACCAATAATGTTGCGCGCTAGACTCGGCACATAGTAGACGTGCGTCAACTTGACAGTTTTTCTTTTTCATTTGCGACCACGAG
AATTCAAAAACTACCAACCAGCACAACAAAACTTTCTCATTGTCGGCCAACGAGATTTTATCATTGCAATCTTCCGCGTCGATCAAAAATCGCTCGTCGT
TTACGAGTTAACTATTGGCACAGCTGTCAAGTATACAGTCATGATTATTATCTTGTCTGCTGTCGCTAACAGCAAGCCCCATATCGCCATCGTTTTTGGA
CATCTAATTGAACTTGTCTTTTGACCTCCATTCGCGATCTTCAAATGTCCAATTTTTCCACAATTGTAGCATGAGCATGTCTCTTTACACTTTCTTATTT
TAGTGACGGCTGCTTTCTGGGGTTGACTCGAGATCTACAGATTGTGCAAAGTGCACTAGCTCCTCAAACTGGCGCAGACAATCATTTCACCCATTTTTGT
ACTTGGACGTCAACATCGTCCTTAGATTAGCAGACGCTTAATGCACGATGTTGTGAAGCACTTGAGCTTCTACGCCTTCGCCACACGCATTGCATACAGC
TACCATGTACAGGTAGTGCTCGGGACATGACCAATTCAAAACCTTCTTAGCTATAAACAATTATATTCTCTGTGACGCCATAATAGTAGTCTTAAATGTT
TGTAGCAGCCTACCCATCGCATGGTCCAGAGAGGCTTTTTCGAGCCACCAAACGTTTACTTGTTTCTAGTAATAGATTTCAGCAGTCCCACTTAGGTAAT
GTCCAGGTAAATCAGCCTTAACATCTTCCGCCCATGCAAATCCACAGGCCTGCTGCGCCATCGTCACTCTGCGTAGAAACGTCCATCCACAATCAGCAGA
TCCCAAACCAAGACCCTGGTATACTTCTGTTCCGTCAGACTTCCGGATCGCAAGATTGCGCTGAAGAACGTCTACGACACATCGGCAGCTCATAAGTTGG
CGCTTGTTGCATCTGTTGCCATCGTACTGCAGCCTTAATTGCTGGAAAAGCGTATATCCTGGTTGCGTCGCATGAACTCGTCAACGTGGTTGTCGCGGAG
CCTCGTATTCGAGCGCATCGCGATGTATAGACCAACCGCCCATGCCGCGTTTCTGAGATGATGCGAAGAATCCACTGTCGATCGCACCACACAATCGCTC
GTCTCGTCAATCCATGAGTGCGGTCAGCATGGTGAGGATCCATTCGTTCGTAATTATTTCCTTTCGTATGCTTAAGTGCCAGATAAGACGGCGACCCTTT
CGTGACCTTGATTCGCAGTTGTAGGTGTCGTAGCTTCGACATTTGGCGGAGCCATAGGATTTGGAAGTATCACCCTGTTGACCTATGTTGGTAAGCTCTT
TTTGAGGTAGAAAGAAAAATTATATTCAATCTGTGTTGATGTCTCCTAACCCCTTGTCTGTTACATCTTCGACAAGTCTGACCGTGCTCACGCACAGCTG
CAACCTACTTAACCCATCCTAAAAGATAGCTCTGTCCCTCTTATGCATATGAAAGTAGACGCTGAAATGTTTCACCAGGCCTGTCGTGCTGCACATCGCG
ACTGCTCGGTGCCCTTCATTATGAAATTTAACACGAAGACCTATACATTATTTTATTGGTAGGACTAATGATACATTTTTGCGGGCGGGGGATCTATAGT
TATGCTATTCAATAGGCCATTCACATCAACGACCGCTTGGCATACGATAGGAGCAAATCCATTGCATCAATGAACGCATTATTACGAACATCGCTAGCTG
GTTTTCGAATGAAGAAGTGAGTGCCGTCTAAAGAACCTGTAACAGGTCCAAACCCACGGCGCTTCAAAACCCATCAGCAATTTATTTCCGGCCGGTCAGA
TCGTGAGCGCCCGGAAAGCCTACAACCATTTTATATGCACATTTGCTTGTATAATTAGCATTCTCGTTTTAACATACGTGAGCTGTTGTTCTCGACTCAA
AATAAACACGCTACAAAGCGGAGACTGCATCCTCTTGCGCATCAGTACAAGGAAATTGCGATGCGCTTAGCAACACGTGTCAAAGCCTGTGCCATAAAGC
TTAAGTTTGCATAAAAACACCATTGCAGTGTGTAATAACTTGTACTGGTTTTACCTTTCAAGTTCCACTCCAAATCAGACCTACGTTCTCCACAAAGCCA
GGAATTAGGCTACGATTGACTTGGAAGTCCTCGAAGAATTGGTTTTTAGTGTACATCAGGACGATTTGTTTCCCTAGAAGTGTATAGCGAATACGTGCTA
TGGTTTGACTCCACTAACGTAACGGGATCACACGACCGTTACCGCCCAAAATGAATATGCCTCGTATATGTGATATACAGTACCACGTTCTATATGTGAT
AATTGATGCGGTTGATAACCTCTTTCATCCATTAATAACAGATTAATGTACCATCCATCAATCCCTTAGGATACTAAGGATTATAATGAGAATTAGTTTA
ACCTTAGTATTAGGTAGTTGTATGAGGTTTATTACAGATAAAACTAAGAAAAAAACAGTTCCCCTTTTGATCTATTGTTGACACGTGTCTAGTTTTGACG
TCGGCAAATCGCAAAGAGTAAGAGCCATCCAGTGACGCGTATTCTAGAG