Description :
From Genome Similarity Track
Location :
Scaffold_380:29440- 31002
Transcript NameFunction/comments
Phymu_g9295conserved hypothetical protein

Sequence
1562 bases(100 bases per row)
GACGCAGCCATGGCAATGGACCTCACGGCggaagacgacgacctgCTTAGCTACTTCCTGTCGGCTGATGTGGCGGCCGAGCAGCCTCCCCAGACACGCT
CAGCGGGTGTCCCTGTTGCTGAGACGTTCACGCTAGGGCAGACTGTCCCTCTGGCGCCCGAGCGGACGTTCGGGAGCGAGTTGACGCcgaccacgacgcc
gtctGCCAGCTCTCCGTCTGCCCCCGCCTTCCAGCAGTCACAGGGAAGTTTCACTGAGAGCTCTATGATGCGGCCGTCCGCCAATGATGACGACTCATCG
TCGAACGCCGGGGGATTGGACACGGATGagaagcgacagcgacgtctgGCCAGGAATCGCGAGTCAGCGCGTCagagtcgtcgtcgtaaGAAACAGTAtc
tggagctactggaggagaaggtgggAGGCTTTTTCGTGCGGTGGAAGGAGAGGAATTTACAGTAACTGATGGTGTTGACTGCAGGTTTCTCAATTGACGG
AGAGCATTGACACGACACGTGCGACGCATTTGGAACGTGCGGACGAGGCGCTGAACCAAGTGCGATCGGATATTCTGAAAAGCCTTGTAGAAGACAGGAA
GAACGGCGGCTCCGAGGAGGTATGACTCTGTGACTTTTGGATGAAATGCTGTGGCTGGTGTTGATATTGTGATGTTGTGGCTTTAGACTGTGCAGGAGAA
GATTCGACAGGGTATTATGCTGATTCAGGAGAGATTTGGACCGAACAGCGTGGTGAGTAGAGGGGGTTTGTACTTGAGCTGAGCTCTGGTATGTGCACGA
TGAGGTAACGTTTGGTTGTTATGGCACTTTTGCAGGAGCGACTGGCAGTAAAGGACTATAACTTCCGCCAACTCGATAACTTGCTGCTCCCTCCTTATTG
CCGGTTCTTGCTGTGGCTCAGCATCCAAGATGAATCGTTCTTTGATGAAGCGAATGGGTTGGGATCCAAAAACGCTGGAGATGTGccagagaagaagaaa
acacCAGTCATGGTAAAGAAGGACACGCTCTGGTCGACTCTTACAAGCGATCTTGCGCTTACCTACGAGCAGGATGAGAAGCTGAAATCGCTTTATAAGT
GAGATTACTCGTGTTTAGGCAATGTACGGAAATGATACTGATACATACATGTTTGTGCTCGTCTTGCAGGTCAGGAGACtccaggagcagcaagtcgGAA
CGCCGACGGGTGGCAATGGCTGTGGTATGTATAGAAACACGAAGGTGGATGCTTGTTCTTTTACTCATTGTGGTGTGCTGTTTGTTCTGCAGACATATTT
AAGCAAGCTGAAAAAGagtcttgagcagcgctcCGAGGCGGTCCAGCGACAAACGGAAATGCTGCACTCCATTTTGACTCCGGAACAGTCGCTCACGTAT
CTGCGATGGGTGGACGCCAACCAGGACCGACTGCCAAATTTCGTAGACAAGACGTTGTCGGTGCCGAACACTGGCGCTTCCGATGCGGTGCGTGCCATCC
TTAAGAAGGACGACCGCGATCTCACGGTGGAGGACGTAACTGCACTGCTCGGAGAGCTGTAA