Description :
From Genome Similarity Track
Location :
Scaffold_15:294273- 296301
Transcript NameFunction/comments
g3153.t1ETL80939.1 hypothetical protein L917_18618 [Phytophthora parasitica
g3154.t1ETI33907.1 hypothetical protein F443_19478 [Phytophthora parasitica P1569

Sequence
2028 bases(100 bases per row)
GTGCTAGATATTCAGAGCAATCGCATCAACGACGTTGATATCGTGGATATCCTCGCCCAGATGCCCAATCTCAAGGTGCTGTATTTGCAAGGCAACGAAG
TGGTGAAGCATATCAAGCAGTATCGTAAGACGATGGTGTACCGCTGCCGCAAACTCAAGTACCTGGACGACCGACCAGTCTTCGATGATGAGCGGCGTCG
TGTTGAAGCGTGGGGGAAGGCTTTGGAGGCGGCTGGCGGGGATATGAAAGCAGCACAAGAAGCCGAACGCGTGGAAATGGACGCAATCCGCCGCGAAAAG
AAGGAGCGTGACGAGAAAAATTTCTTGTACTTTGAGCAGATGATGATCGAAGGCCGACGTAAAAGACGCGAAGAGGAAGAGCGGAAGCGGAAGGCAGAAA
GCCCGGAGGGTGGTGAAGAGCAATCGAATGAGGAGATCAACCCATTCTCTGGAGAAAAGATCGTTCCTGTGCAAGACTGCGCCTTCCTCCAGCAAGAACG
TGAAAAACGCTGGGAAGAGGTGGTTAATACGCCCGATGAATCAGATTTTGGTGGCAACAACACCTCCGATGAAGACAACCAGGAGACTGAGCCGTCAACA
GACTACACTGCATCAACTGGAGCAATCCCAGTGGACGAACGGCGCATGAACGTCTTACATCAATGTGCGACTGTGGGAGCTGCAAGTGCCTCCGGCAAAG
ACGCCTTTGTCAACGCATCTTTTCAAGTGTCGCAAGCAGGCAGCGGTGGCATCGGAGAAATCCCTGCTGCTGTTGTTCCTGCTAGCAGCAATACAGAGGG
CGTTATCCGAGAGGGTTCGACAGCACAAGCTGAGCTCAAGCCCGTGCAAGCTGATAACATCAACGAAGCTACGCCGATCGATAATCTTCCTATTCCTCCC
ATAATGGTGATGCCACCTCCAGCCCCGGTAATTGCTGCGCCACAATCTCCGCCCATGGTGAGCGATGATGCACCGATGGCACAGCTGGGTGAAGGAAGTG
ATGATGAAGCACATGAAATGGCAGAACAAGAAGAGCTGCCGCCAGCTCATGAAGTGGATGCGAATGAGAACTTAGCCAGTTTTCTCCTTCCCCCGCCTCC
CCCGCCACTGACTTCGATCGAGCAAGCTGAAGAAGTGGCCCAAACCCCTTCTCCGCCTACCCATACAGACGTCAATGAACTGGACTGAGTTCACAACCGC
TGTGTATGTGCATTGGACTACGACTCGAGACTATCAAACAATTCATTCACGAAACGATACGTATGCTGGCAGCTCTCAGTGCAAAATCATTTGATGCTTG
CTACTCATGGAAGTGTGCATTGCTCTTGGAAATCAAACTCGTATATCCACAGGCGGAAGATATCCTCAAGTACGTCAAATGGACAAAGTGCTTGGCCCTT
GCACTCATCAAACACTACTTCACGCTCGTTCAGTAGTGTTTTCGCTTTAAATGTTGATCCTACATTCGTTTCCCCGTTGCCAGCCTTGCACTCGTACAGA
ACAAACCCAATGTTGGCAGCAAATGGTGCCAACTCGGAGCTTTTGAACTTTCGTTGTAGTGCTAACTCCAGTGGGGTGTCTGCGCGGAAGTGACCCTCGC
GGTCGCTAGCATGCCGGTTGAAGTAGCTAATGTTCATTAGCGAAGCCAACGGTATGATGGTCTCCGCATGTGCAAACCGAAAGTACCCTTCAATATCGCT
GTTACCATCCACACGTTGCTTCATCGTACGAAAAATATCCTGCAGCAGTGGCGCTGCGATCTTAGTAGACAGTGCGTTCCCATGACTCTTCCTGTAGAAG
TGCTTGAGATCTTGAAAGTAGTCCATAGCAAGCAGCATTTCGTCATCGAAGAAAGAACACCACTGGTTGAACACATCCAGAACAGCCACGTCAAATGCGC
AACCAGCATACGCCGCCTCCATGTCCTTTTGGGTGGCATCCAAAACACCCGACAACTTCTGGAACTTCGCCAGATTCCTGTGCATCTGCTCACTGTCGCG
ATATTTACTGTGCTCAACAGTAGCGCTT