Description :
From Genome Similarity Track
Location :
Scaffold_234:29425- 32416
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.32Vacuolar protein 8

Sequence
2991 bases(100 bases per row)
GGATTCGGAGCGCCGCGGCATCATGGCGCAGATTGCGAATCGCTGTGAGAGCATGCTCGCGGACTCGAGTCGAAGTATTCGATGCTTTACAAAACTGAAT
TAGAGTGCCGAGCACACCGCACTCGACGAGTTTGTTCCGTGAAGCGTGCACCATGGACATGGCTGCGATGGCGCGAGTCGCCTCGTAGAGCACTTCGTTG
TTGCGCGAGACCGGACACACGTACTTGACGAGGATCGCGAGCACGCCCTCGTCAACAAGCTTCAGGATATTCTCGGGGCGCTCAGCAAAGTTGGCGATCG
TGCGTGCAATGTTGTACCGCGTTTGCACAAGCGGGTGAAACGCGAATTCCTTCAGCGCTTGTAGCAACTGCGGCTTGCACATCGTGATCCGTGAGTTCTC
GTCTTCCGTGAGCTGCGCGATCGCGCCAATTGCATCGACCTTCATGCTGAAATCGTTGCCGTGCAAAATCCCAAAGAGGCATTTCACGACTCCACGCGCC
AGCAGCTCAATGTAATGTTTGTACTCGGCTTCTTCGGTGGTATCGCGCTCTTGTTTCTTCTCGGCCGCTGTCTTCGGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGTTTCACGGTGTCCGAGTGGATGAGCACACTGTTGGTCTGCTGCTGCTCGCGTTGTCGATCGCGTTCGCGCTCCTTGCAGATC
AGGAATGTGAGCAACGTGATCACGGACCGCCGTAAGCGTTTGTCGGGTGATGCGTACAGGTTTTTACTCGCGATGTAGTCAACGAGTTTGGACCGGATCA
CGTGCTCTCGATTTGTCGGATTCTTCGCCATTTCGCAAAAGACCACGAACGCAGGCCGCAAGATCGCGCTCATCTCACTTGGCACCGGCAAAGGGCATGA
GCTATGCGGACGGGGTATGAAAGATGCCGCCATCCCAGCGATCATCCCTGCCGACGCTTGCAGTCCAGGTCCTGACTGCGAAATTGCAGATCGTCGACTT
GCCGCGGCTGAACTTGGGCGATGTTCAGGGAGGAACCCATTCGGCTTGTGCGAACCTAATCCACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTTGGCGGAGAAGCAGAATTGCACGATCCGAGGCAACGCATTCGCAGCCACGAGCGCGACGTGGTTCCTCTTATACAGCGCGAGTGCTTCGATGAT
CGAGACCACGAGCAAACATATCTGTAGGTTTGTCTTGGGCGAAGCGAGAAACAGGAGCAACGTCGACACCAAGTTGAGTTCGACGAATCGGCGTCCGTTT
TCCTCTTCCGATACCAGCAGATGCACGAAACTCAGCAGCTCGCGTCGAAAGCGGAAATCTTTTTCCATGTACGGATCACAGAGAATCGAGGCGAGGGTCT
CGAAGTGCGTCGTCGAGTGGTAGAAGAGAAATCGATTGTCGCGACACGCAGCCAGTTGATGCAGAATCGCGGCCGCGAGGCAGCGGATGCGTGAGTCCTT
CGACGTGCACGACGTCAGCATGAACGCAAACCCTTCTCGCTTGGCGACCACCTCACGCAGCTCATCGATCGTGACGAGGTTCATGATGATCTCACACGCG
ATGCGTCGGAGCTTGAGGTCCGTGGCATGCAGCATGGAGAAAATGCAGTCCATGCCGTCTGGGGCTTGCAGGATTTTCGTTTTCACGGACGGTAACCTTA
CCATCGACGCGAGTGCCTGCGCGCAATCGCGGGCGATGCTCGCGTCCAGGCGATCTTGATACGAGCTGAGCATCGAGATGAGCGCTCCGAGTGCACCGAC
TTCCGACAGGATTTCCAGATTCGCAGCTACAGAGCACATGAAAGAGAGGGTTTAGCATGCTCAACTCTACCTTTCAGCTCAAACATATTGGAGGTACGTA
CTGTTTCGACTCAAGGATGCAAGTGCGGCGGCGGCGTCGCGACGCACTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCAACGGTCGAAT
GTCGTCGCCATCGACATCCTGGCGTTTCATGGTTTTGCGCACGAACGCATGCTTTAGCTCCTCTCGTCGCGCATGTGTCGAGTCCAGATCGTTTGCTAGA
CCCGTCAGGTGCTTTTTATTGCGCTCNNNNNNNNNNTTCGGAGCGTCTACCACATACGGGGCCACCGCTGTTGACGCTGGAGCGTGAATCGCAAATCTGG
GGTAAGTCGACTGAGGCGGTAGCTTTGGGATTACAGCCTTGTTGTTGTTGTTGCTGTTGTCGTTGCTATTTGCTCGTAGCTCCTCCATTAGAACCGACAC
CCGCTTCACCCCACTTGGACTGAGCACGACGCTGCTTTTGCTCCGGTTATCTGCAGGTGGGAGCGAAGTATTGACGCTTGCGTCGGCGCCAGCTCCGGTG
ACNNNNNNNNNNAGTCGGCGATTTCGGTTAGGAGAGATTGCATTTACGCTTACACGGCCATGCCCAGCCGTGTCAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAACGTACTCGCAGTCGTTCTCCTTTCAGCTTCTTTTGTGCTTTCGTCTCTCGCAGTTATGGAGCCCGTGACAGCTCTCTTGCGCGGTGTTGCC
TTGACAGCACCAGCAGCAGGCGGAGTTGATCCATGATTGAAGAGACTAGGGGGCGGTGCATTCCAGACGCGTCTGGCAATCGCAGTTGTCGCTGTTCGCG
TGGTTGTGGACGCCAAGACCGATGCAGATTTTGGCCGCGATGTGAGGCTAAGAGGTGGCGTCGCATCGCTGCTCTTCGTGATGTGAGGACTCTCGACAAC
GCCACCTGGACGATGCAGACGTGGTGCGGATGCCGGCATACTTTGTACCAGAAAAGCAGCAAGATGGTTCTCACAGTAGCAGCGTGTGCTCCCTCTGGAT
TGTCTTCTTTCATGGCTGTCACGGGCAAATACATAATTAGGAGAGATCTTACCTGGTCAAAAATACTTTTGACGAACGCACTCAGTCGCTT