Description :
From Genome Similarity Track
Location :
Scaffold_259:2942- 4440
Sequence
1498 bases(100 bases per row)
CCCGACTGCTGCCATGTACGAGGAAAGGCTGCGGAACATATGGCGGAGTCTTCATATCTATAGCCAGGCATCGCTATCGTGCTTCTGGTAAATCAACATG
TTCCTACAACTCGAATGACCTAGCATCTTGTGCTTGGACCCAGGACAAGTTGCCGCCGCTGCCGGCAAATTTCGCTGGCGAGCAAGCACATTGGTGTTTA
TATGAAAATTAGTATGTAAGTATATGCCACTGTGATTAGATAGGTTTGTCCAATCCCTGTGTGCTGAGAACCTCAAAACACGATGAACGACAAAACCATC
ACCAGCCAATCATGTGGAAGCAGAAAACACGACCAAAGTGCGATGAAATGACAAGTTTACTTGGGAACGCATTTTGGATTTAAAGTACGACGGTACTTGT
AAGAGCCCTTAATACTTGTTTTCGTAATGTTCAATTTCGATTCGTTAGTTATGTCCAATAATAGTGTCTATTCTTTGTAGTTTTAGATGGGGTGGGATGG
GAATATAATAGTCCAATGTGGACACTAATTTGTCTGTACAATATGTACAGATATACTGTACTGTATTAATAGTACTATATACTACTAAGTAACTTACATC
TTTTTTCGGTTAATTTCAGGACCTCACCATACTTTTTCGAGAAATGAACAAGCAATTCGCGACGGTTCCACTTCGTTCGTTGTATATTTGTTATATTTCG
CCTGCAACCAAGAAGGTTGCAGTAAATTTCAAACGAGGTTCCTTATATTTCACTGTGTATGTAACGGTTCCGTTCGCCCAAGGACAGTAGGCAGTCATGA
AGTGGTCGTGGGGCCGGCGGCCTTGTGGATCTTGTCGATGACTTCGTTCTTGAAATGGAAGCCGCTGTCGGAGACCCAAATATGGACATACCCAAAGGTT
GTGAACCAGTCGAGGAGGCTATTGGCCGTCGCCGCAGCGTCGCTTGTCTCGCTGGGCCAAAGTTGCACGAACCCGCTCATGTCGTCCTTCATGACGAGGA
TCATCTGCAGGCCGTTCGTCGCCGTGGGCATGGATACCTAGTCGTAATGTATCAGCTCTTGGGGCTTCTCGGCATGGAGCGCCGATCCAAGCGGGCGTGG
GACCACAGAGCCGTCGACGCTGAGGCAGTGAATGCAGGCTTGGACAAATGTCTTGACATCGGTTTCGAGGATGTTCCAGGCGAAGACATCGCAGACGACC
TTGGCCGTGGCTTCGATTCGCCGATGCGGCGCCTTGGTGCGCTATGATGCAGACCCGCTGCTGGAGGAGGTCCGTGGCTCTTGTTTGGGATCCAGTTGCG
GTCTTCCTTGTCGAAGAACAGGTTCTTGTCTTCATTCCACGCCACGCCGGCTGGTGGGGTCTCTCCCCTCTTCACGGCCTCATGTTGGGTCTTGACGATG
CCAGCCGGGCTGGGCCAGTCGAAGTCGGGCTGCTACAGGGGCGACACCATGGCCTAGAGGCACCGGACAGACTTCGTTGGAACTTGGTCTTGGGCGGC