Description :
From Genome Similarity Track
Location :
Scaffold_50:29417- 34194
Transcript NameFunction/comments
Phyra_80504palmitoyltransferase putative
Phyra_80505phosphoglycerate mutase family

Sequence
4777 bases(100 bases per row)
CTCGAATACTCAAAACTTGCGTCCTCCCGCACCCGCTCTCATACAGTAGCTGCACTTTCAGCAGTCGCTGCTCGACACATTTTTCACAAAACGTATGTGT
CCTCTGAATACGCAGCTGGAAAGTGGCTTTGCGTCCGAATTGGTCCTTGTACCAGGTCTCGGGCGGGTGCTGCGTGATCTCCAACGCCGCGTTCAATTGG
TTATCGCGCTGCAATGAAACCGCCGCGGCTGCAGCCTCCTGATGAGCTGTATACGGTGTGGGAGCGATCACCGCGGGCTCCGTCTTCACGGGAGGAATCA
TCGCGTCCGGCGTGGCAACTAGAACGCCGTTTCTTCAATTACAATATTTGTTCTCGCACGAAATCCAATACCCCGACGAAATGACACCCCGCCAAAGTGA
CAGTCGGTCGTCTCACGTGGGCTTCCTCACAGTGGGAATGGGGTGTTGTTGCGAGTGGCGCGCGCCGCGGCCGCTGCGCTACGTGCTGCCGTGCATGATC
GTGGGCGTGATCCTGTACCTGTACTCGTCCTTCGTGGTGTTCAACCACGCGCGCGTGCTGGAGAGCGGCGCCGAGACATGGGAGCTGCTGCTGTTCCACG
TCATGACCTTTTTGCTGTGCTGGTCGCTGACGCAGACGCTGCTGTCCACGGACTCGTTCCTGCCGCGGCGCACGCTGAGCAAGGAGAAGATGGTCGAGCT
GAAGCTGCAGCAGACAGAACCGGCTGACTCGCTAGTCGAATGTAAGATGAACGGCGCCGTGCGCACCTGTCGCAAGTGTCGCGCGCTCAAACCGGATCGG
ACCCACCACTGCAGCACGTGCAAGCGCTGCGTGCTCAAGATGGACCATCATTGCGTCTACATCAACAAGTACGGACAGGAAAATGAAAGCTTCTTATGGA
GGCAAGTTGAAGTTGACGACAACATTGCCTTTATGTGTCTTTTGCTGCAGATGCATCGGCTACTTCAACTATAAGCACTTCGTGCTCTTTCTGGGCTGGA
GCGCGGCGACGTGTTTGTACCAGAGCAGTTTGATTTTCCGCTACGTGCTGGCCGAGAGTCTGGATCGAGCAGCGACGCTCTACTTCTTCGGCAAGCTCGG
ACTCTTCTCGCCGCATTTGCAGGTTGGTCATTATGCTGCATGGTGGAATTGTGCTGTGGTTTTGAGGATGTTTTTCTTTCTCATTTGCTGCAGGCTGTGA
GCGTATTTTTCGGCAGTGCGTGTTTGGGACTGGCGCTGGCGTGTTTCTACTTGATGCACTTGTACTTCACGGCCTGCAACTTCAGCACGCTCGAGTACTG
CGAGAAACGCGATGACCCCGACTACATCAACTACTACAACGTGGGCGTCCTGCGCAACTTTCAGGAAGTATTTGGCACCTTCCGGGAGCTCCCGTACTGG
TTTGTGCCGGTGCAGCCCCCCAGCTTTTGGAAGCGAGACGGGAAGACGTTCCCGCTCAACACCAAGTATATCAAGGTCGACTAGAGAAATTCAAAGGATC
AGCAAAATTGCCATCGTTCTTGGGGTTCTGCATGGCATTAAGTTATGATCGCTGCCAATCCAGTCCACTGAAGGCTGCTTACTAACTAACTTGTCCCCCT
CAGTGCCGGGCTTCCATAGCTCTGCTAGGCCTCTGCGACGACTGCGACGGGAGCGAAATCGCGGTGTCCAGTGAGTCGTCAAAGCGCGTTTGGTAAAAAT
GCTCGATGGCCTTTGCATCTGCTCTGACGGATTCTGCGACGGTGGAAGTTTCGCGCGCAGGTATCTCATCCATGTGCTCTGAAAGCCGCGGCGCATCGAC
AAGTAGCGGTTCTGGGTGATGTACGGCAACGGAGCCTCGTCTTGGAGGAAGCTTCGTATCAATTCCATTGAGAGTTGATTCGCTTGCATCGGCGAGTTCT
GAAGGAGTGCGCGGTCTCTCTGTCGTGCTAAAGAATTCGATAACGCTCTGACGTCGCGGGTGCTGATTGCGGAGCGCTCCAAGATCATCCAAAGTTGGCT
CGCTCGAGATCATTTCATTCAGTAGCCGCTCAAATCCCTCCAGAAGAATGTTTCGTTCGCGCTTGGTCGCAACTTCGAGGACAACGCGCCCGCGGTGGTA
GCTCTTGCACACGATAATTATTCCACGACGGTAACTCACTTTCTTCGCCAACCGCGGAGCCTCTGGGTTCCCTTCCTTTTGAACTGCAATAACCTGCTCG
ACGTCGTCTACAAAAGCAAAGCATTGATTGTCAAGGCTCGAAGCGAGTATCGCACCTCGTGCATCGACAATTGTACGCACGCAAATTGATCCGTGGCTTC
TTTTTCCGCGATGGCGTCCACGTGAGGTAGCACTCCCCAGCGTCTGTATTCAGGACTAGTCGTAGCTGAATTGTCTTCAGCGCCCCCGAGATGCAAACTT
TGCTGGCCGAAAATCCCTCAGCTAACAGCAACCTAAAACTTGCTGCCGACATATCCTCCTGTTCCCGAGCTCGCTGCACCGCTAGTCGACCTCGAGCAAG
CTGCAGCATGTGGTCGCTCACCTCGTGCCAATTCCGCAGTCGCCGATACCGTCGATATATCTGTTGAATGAGCTTGATAGCTCCCATTCGGTTGCCAACA
TCGAGCACGAACACTCTATGGCAGATTAGAAACACTGTCAGCGGTGCACTTGAAGCTATACAGTTAGTGCCCGTCGATTCGTACGAGGATCGACGTTTGA
ACACCGGGTACTGCTGCTCCTTCTTCAAAACCTCCCCCTGTTTCGCCAACACCAAGTCAGCTCTAAGTGAACCCCAACAATATATCCGAAAGCTCGAACT
CACCGGCGAATCTAGCAGCAAGCCGAAGAAGCGTTGAATGGTTCGGCAGAGGCTCTCGTCGCTCCATAGTGCAGGCTCGGCCCTCACCTCATCAAGGAAC
ACAGGTCCGGACCTGGGCGACTTGGCGTCTTCAGTTTCCCCGAGAATCCGCTCCTGCTCTGCCGGCGACGGAATCGACGACGTGCTTAGCAGACTTCCCA
TGCTTTTCTCCGTCCCATTCGCCCGATACTCGCTTGTCGGCGCGGATCCGCGGGAAATCGAAAAGTCGCAAGAAATCGGAATGGACGGACAGAATTCATC
GGAGGGGCCTCTTCAAACGAGAACGGCAAATGCTCGAAGCAGGGGTAAGCGTTGCTAATCGGCAAACGGCTCCTACTTATTCTACCTCACAGCGGGTGTC
TCTTGGCGAACATGGTAGCAGTCGATCCGCTCGCTGCACCTCGGCCCCGACATTTGGCCTTGATCTAGTTGTCCTCGACCTCAGGTCTGGGTCGAAAAAC
TCGCACAAATTCGTCCTCCCACCACCCGACGCCGTACTTATGCTCCGCCACGTTGTGGGAACCCGTGGCGTGGCGCACAAAATACATGACCTTGACGCTC
GTGTCAGTGAAGTCGATTTTCTGCTGGAACGCGGCCCAGGAGGACGGAACCATCGCGAACCGCTGGAAGATCAAACCTCGAGGTCCGCGACGAGTACTTT
CAGCACGGAAAGCCCTCGACGACCTTCGTCCTGCACATTTTGCAATCGACGCCAGTCATTTGTCTGCCGAATGCGAAGATTCCTGCAAGTGAACACCGAA
AGGCAAGCGGTTGAAGTGATGGGATTGGCCATAACATTGCCATTTATAGCTAATCAGGAGAGCAGCGTAATCTTCAGACTAATTTTGTCTGCTCGACGTC
ACTTCGAACGACGCCCTCCCTCGGTCTCCGCTGCCCCTTGCACTGCCCCTTTGCACTGCCATGACAGCGACCACCGATGCGTCAAGTAACTCGACGCCTG
TGGCGCTGACCGCCGTGAAGGCCGTCGACGGCTTCTTCGCGCCCAAGACGCCCGTGGAGGGGAACCCGACGACGCTCTTCAAGAGATTCGACATGGTGCC
ACCGGCCTGGAGCGACTTCCAGCAGAAAATCGCTCAGCTGGAGAAGGAGAAGCGCCCGGACGGCACAGCCAGACAGATCAAGGTCGTGCACTTCCTGCGT
CACGCTGAGGGTACGCACAACGAGGCCCACACCAAGTACGGCTCACCTCGCTGGGAGGACGAGTTCGCTCGCACTGAGGCGTTCCTGGACGCCCCGTTGA
CCCCATTCGGTATTAACGACGCACAGAGCAAGGGGCGGCCCAGCGTCCAAGCGGAGCTGGAGAGGGGCATGCCCCCTATTGAGAGGGTCGTGGTGTCGCC
CATCTCGCGCGCGGTTCAGACGGCGCAGCATTTTTTCACCAAGGAGCAGGTGCCGGACGAACCGTTCACGTGCATTGAGAGCTGTCGTGAAACGTTTGAT
TGCCATACGTGCAACAAACGGCGACCGCTGTCGGAGCTCAAGCGCAGGTTCCCGGACGTGGATTTCTCGCGCATGACGGACGAGGAGGACCAGCTGTGGT
CAACGACGCACCGTGAGACGACTGAGGAGATCCAGAAGCGGGCGCGGGAGTTCTTGCTGGAGCTCTTCCATGAGATTCCGGAGCGCTACGTGGTGGTGGC
TGCGCACTTGAGCATCATTGAGGCGATTTGCGCGGTCACGCTGGGCACCCAAGTGCGTCCAAGCAACTGCGAGGTGGTTCCGATCGTGCTCGAGGCGCTC
TGACTTTGAAATACGCGCGTTGAAAAGCTGTAGAAGAAGCTAAACAGTGCTAGTTGGTGCTGTGATGTCTCCTACGTCTTGCTTCAGCAAAGCAGCGTTA
TATTGGTAGATACATGAATCAACAAACCCTGTTGAGCTTCGACTTCTTCGTGTTTGGCTCAGTCCTCATCCTTCACG