Description :
From Genome Similarity Track
Location :
Scaffold_12:2941- 4851
Sequence
1910 bases(100 bases per row)
AGACTAAGAAGGAACGCTTTGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCGGAAGA
GATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCATTGACCACTGCCGCGA
GAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAGTCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGCCA
AGAAGCCACAGCGCGGTTGGCGCATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTCATCAT
CGATTCGATGGCCAGGAGCACTATCTACAGTGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTG
AGCACGCCGAGCGGCATACTCTGGGAGTGGCTGGTGATGCCGCAGGGGCCGAAGAACGCCCCTCCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCT
CGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCAGACGGGATGAGTGATGTTGAGATGCGCAAGGTGCATCTCCG
GAAGCTGCTTGCGCTCATGTGCAAGCAAAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGG
AAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATTAGTGGCTGACGCCGTCGAACGTCAAGGAGCTGCGGCAGTTCCTTGGCTTGGCCA
CGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGATTTGGACTGCTGAGTGTCA
GCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGATGCCGACCAAGATCGCCCATTCCACGTTGTGTGTCACGCATCCGAC
TTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCTTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACC
CGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGAGGTCTATACGGACCACGC
GTCGCTGCGGACGGCTGTGAAGTCGCCGCATATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGTAGAGTATAACTTCCGGGTTGAGTATAAACCC
GGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCC
CAATGTCGTCACTGTTGGAGGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTATGGCTCAGCACCTTCTGACAATGCTCG
TCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTT
GTCGTGCCCACCTGCGACTCAGGATCATGTATGAATATCACGATGCACCGACTGCGGGGCATTCGGGCCGTGAGAAAACATACTTTCTTCTCACGCGGGA
CTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTCTGCGCGGGCTCCCTTG
CAGTCACTGC