Description :
From Genome Similarity Track
Location :
Scaffold_1666:294- 4860
Sequence
4566 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTCTTCGTGATCTCGATCGACGCCGTGTTCGCAATCATGGA
GGACATGCGGCGCCACGCGTCCGACCGCGAGGCCAACTCGGCGAAGTGCCACATCGTGCGCAACGGCCACATCGAGGACCACCTCTGGTCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCAGGCCATCCAGCCGACCATGAACGCGCTCGTGAATC
CACAGGAGCTCGTGTTGCTGCGCGGCATCGTCAAGTTCGAGACGCCCAACCCGTACATCAACAAGTTTGCTGGCAAGGTCGAGGTGACGGTGAGCGAGGG
CTGCGGCATGGAGGTCATNNNNNNNNNNGGTCAAGAACGTGCTGCTGCGCGGCTGCAACCTGCGCAACACAGACTGGGTCTTTGGCCTCGTGCTCAACAC
CGGGCCGGACACCAAGATCATGCAGAGCGCGAGCGCCGCGCCGTCCAAGTGGNNNNNNNNNNNNNNNCTCTCGATGAACAAGATGATCGGCATCCTGTGC
TTAGGACTTTTTGTGGCCTGNNNNNNNNNNGCCGCCACCTGCTACGTCACCTGGCAGTACGACATTGTGCGAAATACCTGGTACATCAAGCTCAGCGACG
ACGTGCGCGCACAGNNNNNNNNNNGGAATCGTTCATTCAGATGATGTTTTACTACTTTCTGCTGCTCTACCAGGTGATCCCGATCTCGCTGTACGTGTCC
ATGACGAGCGTCAAGTTCCTCCAGGCCAAGTTCATGGTCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGATGGCGCTGAACGAGGAGCTCGGCCAGATCTCGTACGTGTTCAGCGACAAGACCGGTACG
CTCACTTGCAACATCATGGAGTTCCGCAAGTGCTCNNNNNNNNNNNNNNNNNNNNCGCGCCAACAAACCGATCCCGCCGGAGCCAAAAATGGACGCGGGC
ATGAAGAAGATGCAGTACGTCAACTTTGTAGACCCGTCGTTCTTCAAGGCGATGAATGGAGGCACTGGTGCGGCCCAGCGCGACAATATCCACCAGTTCT
TTGAGCACTTGGCCGTGTGCCACACGGTGATTCCGGAGAAATTGGAGACGGGCGAAGTGCGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCGTGGGCTTCAATTTTGTGAATCGAGGCGTGGGCAAAGCCACGATCGAGGTATTTGGCGAGC
GCCAGGTGTTCGATATCCTCGATGTGCTCGAGTTCAACAGTACGCGCAAGCGCATGTCGGTGGTCGTTCGGCGGCCCAATGGCGAGTTGTATCTGTACTC
AAAGGGTGCCGACATGATGATCTACCAGCGACTGAAGGACGATCCGGCAATGGACCAGCTCAAGAAGGTCACGCGCGATCACATGGAGAAGTACGCTGAC
GACGGCCTGCGCACACTGGCACTCGCGGTGAAGAAACTGGACGAGAAATGGTTCCAGAAGTGGAAGATCAAGTTTGACGAAGCACAGGGCAACGTTGCCG
AGCTCGACCGGCGAAAAGNNNNNNNNNNNNNNNNNNNNNNAGCCGAACGCGATTGACTCGCTCATGGAGGAGATCGAAGAAAATCTGGAGCTGATTGGCG
CGACGGCGATCGAAGACNNNNNNNNNNCCAGGACGGCGTTCCAAAGTGCCTCGCGCATCTCACGGCTGCTGGCATCAAAGTGTGGATGCTCACGGGCGAC
AAGGAGGAGACGGCCATCAACATTGCCTACGCGTGTTCGCTCTTGGACAACTCGATCCAGCAAGTCATCGTCAACTGCACGACATGTCCAAATGAAGAGG
CCATCATCGCGCGTCTCAACGCCGCCGGACGCGAGTACCGCGAGAAGACCAAGGCCGACTCGAAGCTCGAGATCTCGCTGATCATCGACGGTGAAGCATT
GGAGTGGGCGCTGAGTCCGCGCACGGCGCCGCATCTGCTGGAGTTTACGAAATTATGCCGCGCCGTGATTTGCAATCGCGTGTCGCCTGCGCAGAAAGCC
GAGATGGTGCGGCTTGTGCGTGACAACATTCCAGTGGCGAGGACGCTGGCGATCGGCGATGGCGCTAACGATGTCGCGATGATCCAGGCCGCGCACGTTG
GCGTCGGCATCTCGGGCCAANNNNNNNNNNNNNNNNNNNNNNNNNTGCAGGCAGTCAACTCGAGCGACTATGCGATCGCGCAATTCCGGTTCCTCGAGCG
ATTGCTGCTGGTGCACGGCCGCTGGAACTACATTCGTATCTCGAAGCTTGTTCTGTACATGTTTTACAAGAACATCACGCTCGTGCTGGCGCAGTACTGG
TACGGCNNNNNNNNNNNNAAAATGTACTGGGAGCTCGGTGTGCAGGTGTACAACGTCGCGTTCACGGGCATCCCGATCATCATGGTCGGCGTCATGGACA
AGGACCTGCCGGCGCGGTTCAGTATCGAGTACCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCCTGAGCGGTACTACTTCAACATGTAC
ACATTCCTGCGCTGGATCGGCGCCGCCGTGTTCGAGTCGTTGGTCATCTTCGTGGTCATGTCGTACGGCTTCAACGCGTCCGAGTCGGCGCCAGGCAGCG
AGTCTCGCGTCGAGTACGGCATGGTAGCGTTCTCCATGACGGTGCTGATCGTGAATATCAAGATCTGGTTGATCTCGGATACTTGGACGTTTCTGTCGTT
GATATGCTGGTCGCTGAGCGTGTTGTCCTGGTTCGGGTTTGCGGCCATGGGCACGGAGGTCACGTTCTTCTCGCGCTTTAAGGTCGCGTACGACGAGTTT
GGCTCGTTCGCACCGACGGCGTGGTCCTGGGGGTACGTGCTCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGGCTGCGTTATTGCACTGGGCC
GCCATTTCACGTACAACCAGTATCAGCGTGCTTTCTACCCGGAACTGAACCAAGTGCTGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCACATCG
AGGAGCAGACTCTGTCCATGTCGCTGGATGACGTGCATGCCACAGCGTTCATGAGCGACTTCCGCGGTACAGACCTCACGGTGAAATCGTACCGAACCAA
CTCTGGCGGCGTCAACATGCACGNNNNNNNNNNTTGCCGAAGACGAAATCTATGAATCAAGTGGCAGCGGCGTGCCCAGTTCGGCCATGTCGGACAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATC
CCGACCAAGTTGTTCAAGTCGAACGCGTCGCGACGCAACACGGGATACGCGTTCAGCTGCGACGAGGAGACGACGCTCGCCGANNNNNNNNNNCGCATCC
AACTCCCTGCCGCGCTCCGACGCCGTGCCCGCGGCCCTGCGGAATTCCATCTCGCGGCACATGTCCTAAGTATTTTGCCAAAAGATGCCGTGGGTCGTGG
AATCTGGTCGTCGCGTGGCGTGATGGACGTCCTCGCCTTCAGCTTGGATTTGAACAGGCGATGAAAGGATGCTGCTGATAATATATATGAACGCTCTTCG
TATTTTTCGACACGAACTGCGCTTGAGCTCATGCAGCCATTTTGTGTCTCAGGTGATTCGAAGAAGCCGAGTTGGCGCACCAGTGAATATGATGGTTACA
GAGCCGAGACTCTGCAAATGCCGTGCTCCCACAGCAGCTTCATGGGTCCAATGCTTCGGCTCAACACCCAGTCGGTTGGATTACTACAGTTGACCAACGT
GCGATGAGCAGTCAACAATCAGAACTTCTCGTAATCCAGAGATGACGCTTTTCAGATTGCGCTTCAACCAATTCGGCTGATGTGGGTGGGAGGTTGATGT
CCACAAGAAAGAATGGTCCATCTCCATTGTTGCCACATTACATGAGAAAACACCCTACTTGAATACACAAAATGGTGTAAATCACCCGCATTCAGTGAAA
ACCTAATTTCAGAAAATCAAGGCGTGCGACATGCTGTGGCTCTCAATAGAGGCCCTTGTTCCCCCGGCGCTCTATTCGAAGCATCTCGAGTTGCTAAACA
AAAAGGAACGTTCACTCTGTTGATCAAGCCTAGCTATTCTCTATAACCTGTTATAATTTATTAATTCAAGCCGCATAACTCTATCATTTTTGAAACAGTA
AATCACCTAATAAATTCATAGTTATGGTCTCCGATGAGATTTCGTACACCTGTGATAATGAATCGT