Description :
From Genome Similarity Track
Location :
Scaffold_174:294- 3870
Transcript NameFunction/comments
Phyin_T30-4PITG_20866Beta-glucan synthesis-associated protein
Phyin_T30-4PITG_20867Beta-glucan synthesis-associated protein%2C putative

Sequence
3576 bases(100 bases per row)
TTACCAGATCGACACTTCAATAACGGTAACGGAACGGCCTTTAGCTGGTTTATTTGTCCCTTACTACAAGTGAGAAACGTCGCTACTATTGCGATTTCCG
GCGACTCGAGTTTCTAGATCGCCCTTCGCCATCATATTCGCCTTGGTGACCGCTGCGTTCCTCTTGGCTGCAGCCGACACGCCTCTCCACACTGAAATGG
ACGTTAGGAAGACAGCGACGGCAGCTACTGCCAACGCTAACGGGATGGGCGGGCCGTACAATCGCGTCGACGCCTTGGACGACGTGGACTCTGCTTGGGC
CACAGTACAACGAGGACCACCCCACGACTTCGGATACGAGCACGAACAGCGTGAGTCGACACACGTTCCCGTGATTAAGTCGGTTCTAGCGTAATTCCCT
CCGACAGTGCAGTCGCTATTGGAGGTACAGAAAGCTTTACCGATTACTTCAGTCGCCAAGTTGTCGTCGTCTTGGTACTCGTCGATGTGGCCTTGGATCC
ACTCTTTAGTCGGATGACTCGCTGGGTCGCAGCTCACTTGCATGTAGTTGTCAGCTTCCAAGTCGTCCCCCATGTCCTGGTACAGTCGAATGTAGTCGAC
CTTCATGAACATTGGGAACTCATCGCAGATCTTGTTGACTGTCTTGTCCGAGCCGTCTCCTCTGCAGGCAGTACCAGGGTTCGGAGGCTTCGTGCCCCAA
GAACTCGATAGCGCAACGTTAACGATGATCGACATTGGCTCCTCTAGCATGACCTTTTGGGGGTTGCTGCTGTTGGAGTTCTGAGGCACGTTAGAGAACG
AGTCAGCCGTCACTTCGAATAGAGGACTGCCCTGAAGCATCCAGCGTGCGTATCCATTCACACCCGTGACCCATTCCAGCTGGTAGACGAGATAGCCCGT
GTACGCGCCGACATGTATCGGCCAATTGGCCGAGATAGCGTCCATCTGGTAGTTGAAAGTATCCATCGCGTTCGACTTTGGCGTGGTGGAGTTCCGAGGA
CTGGTGCACCTGGCGTTGGTGTTGTCGGGATCGCACAGATACGCGCCCATGTACGAGTTCATGATGGGGAAGCACGTGCCGTTCGAGTTGATCCCCCAGT
AGTTTTTACCGGTTCCGTCAATAAAATCCAAGTCTCCGTTCACATCAAGGGAGGCAGGACACGTCGTGGTAGTGCACGAGTTTTCAGAAATCCCACGAGC
GACAGACGCGTTGACTGTGGCGAAATTCTGCACGTTGGCTTTCTTCTTGGCGCAATTGTTGTTTGCCGCGTATCGGAGACCTTGGTACCAGGATTTGTGG
CCTCGCTCTTGCTCGTAAAAGTCCGTTGGAACGTCGATCAAATTTGCTCCGTCGGTCTTGCAGTTGTACGCGTACACGCAGTACGGATTGGTCGCATCGA
CTCCTTTGGCGTCGGCTGGGAAGAGACGAAAGTCCGTGGGCATTCCTGGGGCGATCTGCAGTGATGACGAGATGGCCAAGCCGCCACCTTCGAGGAGATC
GATCTCTGGGGCTCCTCGCCCTTGGTTCGGGTTCATTCCGTAGCCAGGATCATCGTCACAAGCGCTGATTCGTTGGTTACTTGGGTCGAAGATCTCGGGT
TCGCATCGATCGTATGAGAAGGGCCACATGCGGTTGGTGGATCCTGAGAAGATGGCTCGACCGAGGTTCCCCATCATCCAGATACCGGGCCAAGTCGGGT
AATACGAAGTCTCAGTCACTTGTCCATTCTTGCCCAGTGCCAGGTCGGGGTTGCCTGAAGCGGTTGACACGGCTCCGGGTAGCTGAGCTCGCACCTCTAG
CATGCCTCCTTGGAAACAGAATTTGTTCCAGGACTGCACCATGGCAGCTCGATAGTAGAACGTCGAGTTCATGTATCCTGGCGGGTGCGTATACATGTTG
TATACAGAAATGGTATAGTTGTCCGTGTCCACTTCGATGTAAAAGTAGCAAGTCCCATCGTCGTCGCACTTGGTGCTGGTCATGTTGTGTGCGTAGATCT
CGAGAGCTCCATTGACACCGTCCGGTTTATCAAGTGACGTCCACATGTGGTCGTCGCCTGGTCGAAAGCTGCGGTTGGCCACGTTGAACTCGTCGCTCAT
GACCAGTTGCCATTGTCGGCCTCGAGAACTCGTGTATACTTGGCGATCACGGGGAGTATCGGGGTCTACCCATGTCTTTATCCCCGATTTGGTCGGGTAC
TCGGACGACCCGGAGCTGCTCTTCCCTGTGACGAGAGTCGTAACCAAAGCTAACGTCCATATGAACCCCCACATTCTAGCGCTCTATGGATTCTACGTCT
TAGCTAGCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
GTCTCTGTTTTACAAAGGCGAGACGTATACCCCCGTCAATATTTATACAGCGATGAAGTGGTGCTCAGAAGGTTGGCAAGACGTATCGACAATGACCATA
CGAAACTGTTGGAATCACACTGGTATTGTGTCGAAGATGGATTTATGATTTGTACTTAATTAAGGTAATACAAAGTAGTACATTTGGATTCCATCTGCTC
CTCTATAAATATTCGCAGCTCGTAGACTCTATATGGTCCACCCCGCCGAATACGAGGTGCACGACTGTATTACATCACGTAATTTACAAGCAAATGTAAT
GAATTAATAGAGGGTAGAATGCCACAATACATGTACAGTACTACTGTAACGTTAGTAGAATATTTTCATCCACAAAACAACACCGAGGTACTACTGTAAC
GTTAGTAGAATATTTTCATCCACAAAACAACACCGAGATATTTCCTGCTTACACAAAGTTCTGCTTGTAGTTGTCCTTGGGCTGGTTAAAGCTCGAGCCG
AGGTCGCTACTGGAGAGTTGGGACGCCTTAGTCTCGCGCTGTCTTGCTTCTCGCTCTGCGTCCTTGTTTTTCTGCATCTTTTGCGTCTCCTTCGCCGTCA
CTAGAGACGCTAGCCACACCGACCCGATAGACAAAAGGATAGCGACACTACCGACCACCATTGACAATCCCATCGGAGGTCCATACACACGTTTCGACAG
ACTGCTGGAGCTCTCAGAGGTATCAGACTGAGCCTCCGTGTAGCGAGGTCCGCTCCACGACGTGGACGAACACACA