Description :
From Genome Similarity Track
Location :
Scaffold_904:294- 3648
Sequence
3354 bases(100 bases per row)
CGCTTGACCTTACGAGCATTATAGAAATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCT
TGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTTCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCTAACATCCTCAGATCCACGGTA
TCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGTGTTTCTCCCAATAATCACGTGCC
TCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAATTCATCCACTTGGCGCAAACTAGAAATTTTGGCAGCTGACACTTCATGTAGAT
CACGTGTATTATCGACTGGATCCAGGGTTCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTAC
CGGATTTAAACCTGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGT
TGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGGCCTTTCTTGCCACA
CTTCTCACAGACCAGGTGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGG
GATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGATGCAGTGAGACAGACTCGAC
GGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGT
CGGACCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCATTGCCCGCAGCACTTCCTCAAGCTCGTCTGCGT
CGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATTCCCCATC
CTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGGTATTCTAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGT
GCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGAGGATCTGCCCAGCTGCCGATACCAGTTCC
TGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCT
CGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCT
GTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTCCCTCCACTGACTCCATTTCCA
CGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGAACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTTTAAGTGCCG
CTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGAT
AGTCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGG
CTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGAATGGATGCCCCGAAGGTTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTC
AGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTG
GCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCA
GACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTG
CATGACAGTGACTTGATGCAGGAAATCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCT
TCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTG
TTGGCTTAACCGGTGCATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCC
CGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCC
GCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCAC
GGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTG
CGCCCAGACACCGACTAACGGAGGGGGTCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTC
GGTAACTTCCGAAGAGTTTAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGG
ATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTT
GTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG