Description :
From Genome Similarity Track
Location :
Scaffold_1048:294- 2147
Transcript NameFunction/comments
g16129.t1hypothetical protein
g16130.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae

Sequence
1853 bases(100 bases per row)
GCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGGTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCG
CTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGGTGGACGAAGTGAA
GGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCC
CGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATTGCATTGTCGTGCCGGATGATCATGAGTTGAAGC
TCAAGATCACGTACGAGTTCCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCAGCA
GTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCG
TCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGTTATAGTGGTCTTTGTTGACCGCTTCAGCA
AGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGATGGCATGTCTGTTTGTTGACCTGGTGTTTAGACACCATGGTATGCCACTCGA
CATCGTGTCGGATCGGGATCCGCGCTTCACAGCACGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCG
CAGTCCGACGGACAAAGCGAGCGTGTCAACCGCGTGTTGGTTGACACCATGATGAGCTACGCGCACTCGTTCCATCAATGCAGCGACTGCTTGCCGATGG
CGGAGTTCGCCATCAACAACTTGGTGCATGTCTCGACAGGACACACACCGTTCTATGTGAATGTCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGC
GGTAGCTCCTTCCTTAAGTGGGGGAGGGTATCCGGTTAATTCGAAACAACCGGATAAGCACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCA
CGTACTGCGCGCAGTCATGGCGACGACAACGCAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGA
CCAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGC
TTCTGTCGATCGACAGAAGCTTAATGCCGATAACTCCGGCAGAGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTA
GCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCCCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGG
ACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAACG
CTCTCGAGCGCGGCGACGCGCTTCGAGACGCCAGAGAGTCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCT
TCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGC