Description :
From Genome Similarity Track
Location :
Scaffold_2969:294- 2008
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_2969-abinit-gene-0.2Pumilio-like mating protein M90

Sequence
1714 bases(100 bases per row)
AAGCGGCCTCCCACGTCCGAATGGATTGTATCGTTCCAAATCTGGATCCAGCCGGCGACCTGATCACGAGTACTTGCACCCTGTTGCACACTCGTACTCG
TCAAACAGTCTCCTTGAAGAGTTTACCTCGTCATCGAAATCAGAAAAGTGGGAGCTGTCTGCAATCAAGGGCCACTTGCTTTTGTTTGCTCGGGATCAAA
GTGGCTCTCGATTTATTCAGCAGAAGCTGGAAAAGGCTGGCGATCAAGCTAAAGAGGAAGCGTTTGAAGAAATCTACCCCAATTGTCTTATCCTCATGAC
TGATGTCTTCGGCAACTACGTCATCCAGAAGTTCTTTGAGCACGGGTCACTGAAGCAGCAGCAGCTCTTGGTGGAGCAGATGAAGGCCAACATGATTACT
CTTGCTCTTCAGGTCTATGGCTGCCGAGTCATTCAAAGAGCGTTGGAGGTAACTCAAGTCGCTGAGCGATTGTCTTTGATTGCCGAGTTGAAAGGGCATG
TGATGAAGTGTATTACCGACCAGAACGGCAATCATGTTCTTCAAAAGTGCATTGAAGCTGCTTCATGGAAGAAAAGTGTTGCATCTGGTGAAGCTCCTGG
ATTGCAGACAAGAGTCACTGGCGATGACATTCAGTTTATCGTTGATGATGTTCTCGGTCATGCTGCTGCTCTATCAACCCACTCGTACGGCTGCCGTGTT
ATCCAGCGAATCTTAGAGCATTGCTCTCCAGTCCAGATTCGCCCAATTATCAGCGAGATCATATTCAAGTGCCGTGACCTTGTGAAAGACCAGTTTGGAA
ACTATGTTGTGCAGCATGTGATCAGCCATGGTGAACCAGATCAACAAAGAGTGGTGATGGACGCTGTCTTTCCTGAAATAGGCCGGTGGAGTCAGCACAA
GTATGCCAGCAATGTTGTTGAAGCGTGCTTGGACCATGCAAGCAAGGCTGAGATTGCGCGAACCATTGACTTTATCCTGCAATGTGATGAAAGCGGATCG
TCGTGCCCATTGCTACCGATGATGAAGCACATGTACGGAAACTATGTGGTGCAAAAGCTTCTTGATAAAGCTGACCCACGCGATCGCCAACGAATTGTAT
GTATCGTTCGTCACAATGCGGATTATCTCAAGCGCTTTACCTTTGGGAAGCACGTGCTGAGCCGTTTGGAGCGAGAGCTCGCTGCGAGTTATTAAAGTCT
TGAACCGACGTGCGCTTCGACCATGATCACCAGCAAATTTTCACCACCAATTGTGACTGCCGAACATGTGCGCCGATGAAGTTTGAAGAAAAAAGCAAAT
TTACGTTATACGAGTATATAAATATTTTTTCGGTACCAGTAGTTTTAGTTGTTTGAAGTGCAAGGATTAATATACGTGAGAGTATTTCATGACATCCATT
TTCACGCGTTACATCATGATGGAGCTTGTAGTAATAGAAGATATATATTGAGTGCAGCTTCACCAAAGGCAAGAACAAAATGCACACCGCATCTCGCCAT
CGCATATGCAAATGATCTGGAATATAATCTAGCTTTGAAGGGAGTCAGCCACCTGGTTTGCCGCGCGAGTGCCGGTATCCATAGCGCTGTGCACCGACAT
GCCAGGCTGTTCAAAAGATGTGGCTTCGCCTGCAAAAAAAATGCGGTCGTCGATGGCTTGTGCGAGGTCGCTGGCAGCAGAGTCCGACTGACCCACGCGC
GGGTAACTGTAGCC