Description :
From Genome Similarity Track
Location :
Scaffold_921:294- 1347
Transcript NameFunction/comments
Phypl_g11652C2 domain-containing protein, putative

Sequence
1053 bases(100 bases per row)
CCCACGCGTCCAGGAtgtgcttgcgcttctccttcagctccggACTACcgcgctccagcgcttcgacCGAGATACCGGGAAAGTTGGTTTCCAGCAATGC
TTTGAGCTGTGGAAGTTCCTCCTTCGGCGGTGCGTACGTGCCGCTGTTGTTGTCAATGAACAGCTGGAACTCGCCCGAGGACCCCTTCTCAATGTGGAAC
TCGCCAGCGTACTTGACGGTAAACTGCGCTCCAGAGTGCAGCATGTGCTTGGACAGAATGTCCTTAAAGAAGGCAGCTCCGGTCTCGGAGAAGTACCAGC
CCGTCTCGATCATCGCGTACGTGAACAGCACAGGCTTGTCCAGGCGCTTGCCGTCATGGAGCAGGTTGAAAAAGTCGGCCGCCCCCTTGAACCCGCCATA
GACCGTGTCCGCGTCGTGCTTGTAGACCACCGCGTGCTCCGTCGCCACGGCCTTCCGCAGCACGGGCGACTCCGGGTGGTCGGGCGAGAAGATCTTGACC
ACGGGCTTGTGGTTGTGGTTCCACTCGTTGTCCCGAGCCAGGAAGGTCGGGATgtcgtgcagctgcacgtgGTAGGCAAACGACTCgcgcttgtcctcgt
ccgacgtggTGTCCGTGATGATGCCGTTGACAAAGCTCTTGTGCACCGAGTAGTGCACGGGgccgacctgctgcagctggccgtTGCCAATGACCGGCGT
CGCGTGCGACTTGACCTTGACCACGATGGTGCCGGCCGTCTTGTTGTTGCGCGTGATGGGCAGCTCGAAGGTCGTCTCGGAGCCGGCCGTGTTGGCCGCC
GCGAACTGCGTCTCACCCAATGCGTCGTCGGCCTGGAAgtccttgtccagcaggtAGAGCTTGCAGACCGTGTCGGGCTTGACgttcctgaagaagaact
tcTCGTTCCAGACAGGCTCGAGGGTGGAGAAGACGGGGCGTGTCCAGGCCACCTTCTGGCCGGCCACCTCGACCAGAGCGTaggcgtcgctggaggcCAC
GTGGCCCTTGACCGCGGCCTTCGCTGTGAAGTAGTCGCCGGCCGCGATGTCCT