Description :
From Genome Similarity Track
Location :
Scaffold_1184:294- 1305
Transcript NameFunction/comments
Hyaar_Emoy2814613hypothetical protein

Sequence
1011 bases(100 bases per row)
AAAATGGAATTAATGGATGTAGACAAGGTGGAGGAAACTCTTCGAGCGTGCCAACGGATGGAGATTCGCCAGATAAAAGCGTCGATGGGATCAAAAAAAT
TTTATGAGCGAACGACCACTTCTTCAAATCCGATGTCGTCGAAGACAGCTCGGGCGGTGCGAGCGATCCGCGAAAAAGTCGAAAACAGCGGATCGGAATT
GGACTCAATTGGATCCGATGAAGATATGGATCGTCGTCGAGTTTGTGTAGCAACTACATCCGAACAAACGAAAAGCCGGACAAGGATCACCGAACCTGAC
AGAAGAATGCTGGTGAAACGCATGGACGCGATCGTGGTGGACGATAGAAGGTGGGTACCCATTGTAGATTTACCTGACGCGATGATTGAAGGTGCTGGAA
GAAATTGATGTGCCAGAAGTGTGGTTGCAAAAGAGATCCTTCTGAAAAATATTTTCCGTGTGTGCAGCATGAGGACAGATACACGACATTGGCAAATGAC
CCGTGGAAGAATTTTTCAACTTGATCCGAAAGTAGTACATGACCACGAAGAATGCTGGAATGTTTTCGCCCAAGGTGGAGGAGATGTTAAACTAGGACGC
TCGCCAGGTTGGAATCTGGAACGAGCCGAGCGTTCTTGGCTTTGGATTTATGCATTTGTTGAAGGTCTACAGAAGGATCAAGAGATTAACGATCAAATCG
ATCCGATCGCTAATATACTTAGTGATTTTACATTGGTCTCGTCAATAGCAAGTGTGAAAAGAGTAAATGAATACGCCCGATCACATGTGAAGATAGATCT
CGACTTCGCACCAGAAGAAATCACGCGGGTATTGGAAATACCATACTCCCGGAAAATGCTTCAAACAAGCAAAAGTGACGGGCAAGATCAACAACGAGAA
AGCCACCATGCTGTTCGACTCTGGCGCGGAAGTGTCGATCCTCGATACTACCTTTTCTCGTAAGGTAGGATGTGTGATCGACGAACGTCAAACACAAGAG
TGCGTTGGAAT