Description :
From Genome Similarity Track
Location :
Scaffold_15:29391- 31538
Sequence
2147 bases(100 bases per row)
GGTATGGAATTCGAACGACGTACCACTCGGTAAACGGTTTGCGTGCCTAAAGGGCCATCAAGTTGCTGTGCGTTCTATCAGCTTTTCTCACGACGGCAAA
TTGATTGCTTCCTTGGGTGGCGACATGTACAACACTATTTGCATCCACGACTGGAAAGCACAGGAACTGCTGGTTAGCGCTCGAGGTCACACGTTTCGAG
TCCACGCGGTTGTATTCAATCCGTTTCAAGCGTATGGCAGACCAGAATCCCATCGATCAAAGAAACCTGGACAAGCCCtacacgacgacgatgctTGCTA
CACTTTGGTCAGCTGCGGTGTTCGGCATATCCGCTTTTGGACACTCACAAAAGCGGACTACGTGCCCCCGCCATCAAAGGAGAACGCTGATAGTGCTTTT
TCTCGCTCCACGTTTGGTGGGCCTCCAAGACTGCTTCCTCCGACTCCGACCGAGAAAGTGTGGAAACTGGAGGGCAATGTTCCATCATTTCATGGGCGTT
TTGAAGTCCAAGACTTTACGAGTTTGACATGTGTGAACGATTCTCCACctctctacatgtatgatgAACACTCAAAGGAGTTGGTGGCGACGAATGCCAC
AGATCATTCGCTCGGCCGGATTATAGCTGGCACGGCTAAAGGAGATTTGTGTCTGTTCGTGCAGCCAAGAGCGAGTCCTAATATTGATATCATTTCCGAG
AGAGACTTACAAAAAGAGCCTGCGAAGTGGTGGGAGATTCCAGATGAATACACTGATGCCGAAATCAACGAACTCGTAATGGAGAAAATCGCATACGAGC
CGACTGGAAGACTCGTTGATGTCGTACCACACGACCAAGAAACTGGCAATCGTTTTAAGTTGCCTAGACAAGCTCAAACGGAGATGGAAGGACTGTCAAA
GCAAATGACATTGCGGCCTAACTCAAATGCCTTGTATTCCCGTTTGGGTGAACTAAAATATAGTGGACCGCTGGCTCATCAGGGAGCAGCTTACCAAGTG
ACCTACTCCAAGAAGCTCAATCTGATCATGTCGTGTGGAAACGACGGAAAATTGCTGTTGTGGACGTGCCAAATGAGCAAGCCCATGCGAATTCCTGGAG
TTAATACACAAGGAGTATTCACGCCACTGACAGGGACGTTTACGGAAGGATCACACTCCATTCTTCCTTGCGACGACCCAGCTAAGGTGTTTCAATTGCC
GAGTGTATTACCAACTGAATTAAGCGCgagcggtgctgcagctacaCCCAAGCCCACGAGTATCGTGTGGAAAGACGACGGCAATTTCGTACTTGTTGCC
ACTAGCAACAGTTGCATTTGGGAACTTAATCTCGCATCCGGTGAATGGCAATTGCTGTTCGAAGCTCGCAGTGGTGCCGTGGCAGCCTGCGCCGCACACC
CCACAATAGAAGAGGTAGTTACGGTGTCTCAAGATGGGTACCTTAGCTTCTGGGATCTTGAACAGCACGTGTGTAGTCGCCGTCTCTACCTTGGAAGTTT
TCTTACCTCTAGTGTCAAAGCTTTTTGCATGGAGTTTCACCCCGCTGGACACGAACTTGCAATTGGACTCAGCTCaggtgagctgctggttgtggaCTGT
GATGCGTTTAAGGTAGTACTACGGAAGAATATCAAGTCCAACTCCGGCAGCACAACAAATCTACATTTGGGTCTGCCCAGCCGAGCAATCTCTCAGGTGA
GATACTGTCCAAATGCAAAATATATAGCAGTGGGGGTGAAGGACACTTTCCTTTACATCTACGACATCATCAATGGCTACAAGAAATTTCATGTTTGCGA
AGGTCACTCAAGTGCAGTGATGCATTTAACGTGGAATAAGGACGGCGATATCCTTCAAAGCAATGCAGCGGATGGCGAGATTCTCCACTGGCTAGTATCT
CCTGCAAAGGGCGAAACCAAACAGATAACCGACGCTTTCCTTGTCCGTGATGTTCAATGGATTAAATGGACCTGCGTGTTTGGGTGGCCTACGCCTGGTA
TTTGGTCAGAGGAGACACCCAACCTTGTGGATATCGCTGCAGTCTGCACTACGGGCCCGAAGGTGGTAAATGAGAATGCCGAGGCAGGAAGCACGCACTC
GACCTCAAACGAAGACATGCTGGCTGTCGCTTGTAGATCAAGTGTCC