Description :
From Genome Similarity Track
Location :
Scaffold_53:293909- 294997
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16112ATP-binding Cassette (ABC) superfamily

Sequence
1088 bases(100 bases per row)
TTACAAACCAGGGTGGACGCCAAGATAACCTGGTGTCGGCTCACCCTGCACCTCACCGAAGTAAAGCGCAAAGGTCTGCTTCAGTGCCTCCACCTTGGTT
CTGTTAGCCATGAAAATAGGAAAGGCATCCAGGTTAGCCTCTGGGATTTCCCACGGATGGCTCGATCCAGTTGGAGCAATATCTGTACGCACTGTCTCCA
TCACGACGGACTCCTGCACCTCCGTTGAGAGGATCCAGTTCATGAAGAGCTTGGCACTCGCCGGGTTTTTAGCCTTGGCCAGGATAGCAAGACGCTGGCC
CCACGTCAGATACTCCGTGCCATTGCTACCCACATACACGATCGGAGAGGCTCCAGCGTAGGTGCCCACGCCGATGACCTTGTCTTGAGCGGCCACGAGG
TTGTTCGCCACATGTGAGCCGCGGTTGAAGCTAATGCTCTGGTTAGCCATAGCGGTGACCCAGTCCCAGCCGTATTGTTCCACATACAGACTGTAGACGA
ATAAGACAGCGTCGTCGTCGTGAGGGTACGACGAGGCAATCTTGCCAGCCCACTGTGGGTCAACCAGGTCAGCCGGAGACGTGGGGGCGTCCAGGTCGCC
GAGGTTACTCGAGTCGTAGATGAAGCTGAAAGAGTTCACACCGTACGCGAACCAGGCACCGTTTTCGTCCTTAAGGCCGTCGTAGATCTTGGAAAAGTTG
GCCGGCTTATACTCAAGCAGGTCGCCCGCGCTAGCCCAACGAGGGAAGTTCTGCACAGTCTGCAATGCTGTGATGTCCGGCACAAGCGTGTCGGTATCGA
GCTGGTTGTCAATGCGTACGTCGTGGTACTTGCTGTAGTCCACCACCATTGTCAGGTTGATTCCGGGGAAAGCGTTTTCAAACGCAGTTTTCAATGAGTC
CTGCTGGCTGGCAAGGTCACCGCCGTGGTAGAAAATGAGCTTGCCACCTTCAGCGATAGCGTCTTCGTATAGCTCATTGAGCGTTTTGGTCTCTTCTTCG
ACGGCGTCAGCACTAGCGGCAAGGAGGGCGATTGCAGCGGTGATTGGTGCGAAGAGCTTCATTGCGGTGGTGAAGGTTTGGCACCGGT