Description :
From Genome Similarity Track
Location :
Scaffold_15:293897- 298674
Transcript NameFunction/comments
g3153.t1ETL80939.1 hypothetical protein L917_18618 [Phytophthora parasitica
g3154.t1ETI33907.1 hypothetical protein F443_19478 [Phytophthora parasitica P1569
g3155.t1RAW43019.1 hypothetical protein PC110_g814 [Phytophthora cactorum
g3156.t1ETM34128.1 hypothetical protein L914_18713 [Phytophthora parasitica

Sequence
4777 bases(100 bases per row)
ATCAAAAACCTGGACGAGTACACGGGTCTGAAGGTTTTGTGGCTGGAGGGTAATGGTTTACCCCGCATCGAGGGACTCGAGAACCAGAAGGAGCTGCGCA
CGCTCTACCTGCACGAAAACCTGATCCACCAAATTGAAGGCCTGGAGTCGCAGCTACTGCTCGACACGCTCAACCTCTCTCAAAACCAGATATCCTGTAT
CGCGAACCTCGGGCACCTCAAACAGTTAACGGTACGTGAACAGTAGGTCGTTGAGTGTATCGAATTGTAGCCTGACTTTGCTTTGGTCGTGGCTTTCTCA
GAGTCTAGCGCTCAAATCCAATTACCTGACCAGTGCAAAGGATATCGCGCACGTGCTGGAGCTACCAAACCTTTCGGTGCTAGATATTCAGAGCAATCGC
ATCAACGACGTTGATATCGTGGATATCCTCGCCCAGATGCCCAATCTCAAGGTGCTGTATTTGCAAGGCAACGAAGTGGTGAAGCATATCAAGCAGTATC
GTAAGACGATGGTGTACCGCTGCCGCAAACTCAAGTACCTGGACGACCGACCAGTCTTCGATGATGAGCGGCGTCGTGTTGAAGCGTGGGGGAAGGCTTT
GGAGGCGGCTGGCGGGGATATGAAAGCAGCACAAGAAGCCGAACGCGTGGAAATGGACGCAATCCGCCGCGAAAAGAAGGAGCGTGACGAGAAAAATTTC
TTGTACTTTGAGCAGATGATGATCGAAGGCCGACGTAAAAGACGCGAAGAGGAAGAGCGGAAGCGGAAGGCAGAAAGCCCGGAGGGTGGTGAAGAGCAAT
CGAATGAGGAGATCAACCCATTCTCTGGAGAAAAGATCGTTCCTGTGCAAGACTGCGCCTTCCTCCAGCAAGAACGTGAAAAACGCTGGGAAGAGGTGGT
TAATACGCCCGATGAATCAGATTTTGGTGGCAACAACACCTCCGATGAAGACAACCAGGAGACTGAGCCGTCAACAGACTACACTGCATCAACTGGAGCA
ATCCCAGTGGACGAACGGCGCATGAACGTCTTACATCAATGTGCGACTGTGGGAGCTGCAAGTGCCTCCGGCAAAGACGCCTTTGTCAACGCATCTTTTC
AAGTGTCGCAAGCAGGCAGCGGTGGCATCGGAGAAATCCCTGCTGCTGTTGTTCCTGCTAGCAGCAATACAGAGGGCGTTATCCGAGAGGGTTCGACAGC
ACAAGCTGAGCTCAAGCCCGTGCAAGCTGATAACATCAACGAAGCTACGCCGATCGATAATCTTCCTATTCCTCCCATAATGGTGATGCCACCTCCAGCC
CCGGTAATTGCTGCGCCACAATCTCCGCCCATGGTGAGCGATGATGCACCGATGGCACAGCTGGGTGAAGGAAGTGATGATGAAGCACATGAAATGGCAG
AACAAGAAGAGCTGCCGCCAGCTCATGAAGTGGATGCGAATGAGAACTTAGCCAGTTTTCTCCTTCCCCCGCCTCCCCCGCCACTGACTTCGATCGAGCA
AGCTGAAGAAGTGGCCCAAACCCCTTCTCCGCCTACCCATACAGACGTCAATGAACTGGACTGAGTTCACAACCGCTGTGTATGTGCATTGGACTACGAC
TCGAGACTATCAAACAATTCATTCACGAAACGATACGTATGCTGGCAGCTCTCAGTGCAAAATCATTTGATGCTTGCTACTCATGGAAGTGTGCATTGCT
CTTGGAAATCAAACTCGTATATCCACAGGCGGAAGATATCCTCAAGTACGTCAAATGGACAAAGTGCTTGGCCCTTGCACTCATCAAACACTACTTCACG
CTCGTTCAGTAGTGTTTTCGCTTTAAATGTTGATCCTACATTCGTTTCCCCGTTGCCAGCCTTGCACTCGTACAGAACAAACCCAATGTTGGCAGCAAAT
GGTGCCAACTCGGAGCTTTTGAACTTTCGTTGTAGTGCTAACTCCAGTGGGGTGTCTGCGCGGAAGTGACCCTCGCGGTCGCTAGCATGCCGGTTGAAGT
AGCTAATGTTCATTAGCGAAGCCAACGGTATGATGGTCTCCGCATGTGCAAACCGAAAGTACCCTTCAATATCGCTGTTACCATCCACACGTTGCTTCAT
CGTACGAAAAATATCCTGCAGCAGTGGCGCTGCGATCTTAGTAGACAGTGCGTTCCCATGACTCTTCCTGTAGAAGTGCTTGAGATCTTGAAAGTAGTCC
ATAGCAAGCAGCATTTCGTCATCGAAGAAAGAACACCACTGGTTGAACACATCCAGAACAGCCACGTCAAATGCGCAACCAGCATACGCCGCCTCCATGT
CCTTTTGGGTGGCATCCAAAACACCCGACAACTTCTGGAACTTCGCCAGATTCCTGTGCATCTGCTCACTGTCGCGATATTTACTGTGCTCAACAGTAGC
GCTTTTGTTCTGGTCAATCTGCGCTTCAAATGCAGGGCAATTGTCATAGAACCGAAGCACTTCGTCATCCCCCATCGGGTCGCTATGGTAGAACACCGGC
TGCAGTCCGTCAAAAAATCCAAAGGCAAAAGCCTCCGCACTTTGCAGCGTTCGGATCTTCCACGTGTGCTCAAACACAAACTTGCTAGCATCATAGTGCA
CCGACAAGTGCGAAAGTCGAGCGCGTAGGCGTTGTCCAATGTCGATCAGTTCACGGACACCAGGATCCGCAAGCCACGCCGCCGTCTCCTCTGGGTACGG
GTTTTTCCAGCTTTTCAGCCACGAGGGACTTGTCTTGGATTGAGCTGCCAATAGTCTGGCGTGTGCATCATTAATCTGGGTGATGTGCTTCATTGTGGGG
TTCCTAGTTCCGTGGCGAATGGCAAAGTTGAGCTGCACGGGGGTGCACGTATCCGGAATCTTTGATTCGGACGGCGGCGGTGGTGCGTACAGTGTCTTGG
TGGACATGTGCGTACGCAGAACTCGACGGTCTTCTCCAGCAGCGTCGATAACCACGTAGATTGCGGCTACTAGCAGCGAAAACCTCATCAAGCTCGAGCA
TCGGGACATTCTTCCTCTCTTTCGAGTCGACAAATGACGAATCCTAAAAATAATAGACGCTATCTTTCCGATCCGTTAGTCGCAAAAAATGTATTCGCCG
TGTTCAGCCCCACGTTTCCCAGTTTGAAAAATGAGCAACACCTTCACGCGGGTACACGAAGGCGTGTATCGCTTCGCTCGAGGTGGCAGTGTCGGTTCTA
GCACTGGCCCCAATGTGACGTTGGTGGGTGGAGTGCACGGCAACGAGCGCATTGGCGTGGAGGTGCTGGACGCATTGCGTCTCGCTCTACTGCGAGCTGC
ACCCCTGTCTAGTGCCAGCAACCGCTTCCCACTTATCACGAACGGATCGTTGACGCTGGTGTACGGCAACCCGAGGGCGCAACGTATTGGCAAGAGGGGC
AGCGATCCCCACGCAGATCTGAATCGCTGCTTCCCACAGGATCTACTGGAAGTGCCCGAGTCGCAAATCGGATCGGGCTACGAACACCATCGAGCGAGGG
AGTTGGCGCCGTTGTTTGCAGCCAGTGACTTGTTGCTGGACTTACACTCGACGAATAAGCCGTCACCGCCGTTTGTGAGGCTGTCGGGGTATCACAAGGT
GCCGTCGCAGCTTTTGCAGATTTCGGGACGACTGCCGACGAACATTTTGCTGCTGGACCCGAAACATCTCATTGGAGATGGAGAAGTGGCGTTGACGGAC
GAGTTTGTTGGTGTGCACGGAGGTATGGGGGTCTGCTACGAGAGTGGGGTGGCGAGTGATTTGTCACAGGCTAAAGTTGATAGCATCACGCGAAGTGTGT
TGCGGATTCTGGAGCAGGATATGAATTCGATCGCGTTGGTGACTGCAGATGGGCAGACCTCCAGCAGTGACGATGCTAACCTGTACGATGCAGAGGCTGC
TGCATCCCCGCGCGAGGTGTATGAGATCACGCAGTCGTTCAAGTTGACGAGCGATGGCTTCCGCTGGGCGGACGGAGTCGGGGGCGAGAACTTCCAGCGT
ATCCCCGGAGGCCAGCCGATTGGCTTTGTCGGAAGCGAGCTGTTCACAGTGAACTACGACTCGCACATTGTGTTTCCGAAGATTCCGGCCCTGTGGAAAG
TTGACGCGTAAGTCTTAAGTGATAACTGCTGCATGTACGAAGGAGTTGCTGAGTTTGTGATCTAACTGCTAGGGACGATGACGTTTTGTGTTATGCTGCA
GACCGCTGGGCTGGCTGACGCGACGGATCTCTGTGTAGGGAAATTTACTACCGTTACGTGCCGCTATACATGTAACAAAAAATTAAAATCTACGTGGTAT
TTGCTTGACCACTTAGCATTTTCTTGTCTACTTGGCATTTGCTTGCTTCGAACTGCAGTACGCTGCAAATTGGCCTCTTCAACGTAGCGAAATGTAGCCA
TCTGTGACAAAACTTGCACTTATCCATATTTGAGCCAAGTCACTTTTGATTCCGCATCGATGGCCATCTACCGCGTGGACGACGGCGCGCGCCGCGTGCT
GTTGCTCGATGACCCGGACGCCGACGCCGACGTGAACCCCAGCGACAACACTAGTGCCCCCAAGCAACCCACCTCCACCGTCGACCCGCCAGCAACCCGC
GCAGAGCCCACGAAGTCCAGGACGTCCAATCCCACGAAGCCCAAGACGTCCATGACGACGACGACAACGAATAAATCCTCGTGCATTCCCTCCACAGAGA
GCGACGCGCCGGACGTGACGCTGCACGTTGACGGGTGCGCAGTGGCGGTCCACCTGTCGGTACTGCAGCTACGCTGT