Description :
From Genome Similarity Track
Location :
Scaffold_311:29382- 30963
Transcript NameFunction/comments
Phyci_35164hypothetical protein

Sequence
1581 bases(100 bases per row)
GGATACACGTACAGCCGCGTGTAGCCCCAGGAGACCAGGAGCACGACGTACATGGCCACGATCAGCGGGGTGTTGCCCGTGTCCACCACCGACTTGATAG
CGTCTGTTAGCACAAGCAAGTAAACGGAACACCGCAGAACAACGTTAGTCATCCTGAGTTTCCCACCAAAGAAATTGCAATAGGAGTCTTCTTACAGCCA
GTGACGTCTCCGATATCATGTGTGAAGGTCACGAGCGCTCCCATGGCGCAGTAGTTCGCCAGGTACGACCCTCCGATGAGGATGATCGTCACCAAGTGGT
GCAGCAGCATCTCGATGAAGTCGTTGCGGATGGGGGAGAACAGCAGCATGAACAGCAAGCTGTGGAAATGGTAGCCGAGCTGCACGAAGTAGTAGTACTT
GAGCGCGAAGCCCGGGGCCTCGTGCAGGATCAAGTAAGTCTCTCGGATCACGCCGTTGCCTCCGAGCACGGGCGGGAACCACTTCTCGTCGCGCATGACG
TAGTACCCCGCGACGGTGATGCCCGCGAACCATCTGAGCAAGGCAACAAGGAAGAGGGAAGGAGTCACAGTTTAGTCAGCGCTGCCCAATGAATCCTCCG
ACCTTCAGAGACGAGGCGGCTCTCACGTGAACTTGAAGAGCACGGTGGCGAAGCGCTCGACGCGGTCTGGGTGCTGCCGCTTGGCCGGGGACAGCACGCG
GCGGCCGAGGGGCTTGGCCACCGCCAGGAAGGCGAAGCGCAGCGCGATGATGAGCAGCGCGAAGCCGATGCCGACGAGCCACTCGCTGATGTGCGGCATG
TCGGGGTTCGTCTGGAACTCGGGGATGGCGGCGCGCATCTGCGCCACGCCGAAGAGCTCGGCCAGCACGATGGGCACGAGCGTGAGCGTGAGCGCCACCA
GCACGTACTCCTTGGCGCTCAGCAGCACCTTCATCTCCGTGGCGGCCATGGCTGCTCGACGGTCGCTCGGGGCCTCTGCTCGACGATCAGGGGGCAGGAT
GGGATATGCCGGTGAGCAACTGCTTTTTTGTATCGGACCAAAATCATAAAATCGATGCCAGAATAGAACCCGAATGTGGTCCACACACGCTTGCAACCTA
TCTTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN