Description :
From Genome Similarity Track
Location :
Scaffold_26:293809- 326093
Transcript NameFunction/comments
Phyra_94902PREDICTED: UPF0563 protein C17orf95 homolog
Phyra_77748conserved unknown protein
Phyra_94906Hypothetical protein
Phyra_77750sucrose proton symporter
Phyra_77751PREDICTED: protein WWC3-like
Phyra_77752Hypothetical protein
Phyra_77753pattern formation protein, putative
Phyra_77754PREDICTED: ATP binding domain 4-like
Phyra_77755pre-mRNA polyadenylation factor, putative
Phyra_7155060S ribosomal protein L211 putative

Sequence
32284 bases(100 bases per row)
CAGGAGTCGCAGTCTGTAAGAGCGGAGCAAGCTGCATGGCGTCGGTGCGGCGTCTGCTGTTAGCTGAAGGCCACGACGAGGAGCTCGGAGCCTTTCGTCG
ATTGCTGCAGCCTCGGATTTCAAGTGAAAAACTGCAGATAGACGTCACCCTTTGAGCTGCGAGTCTCCTGTTTTGCAATTTGATAGCGACGACGAATGCC
GTAACAACTCGCAGTCATTGCTAGAAGATCTGCTACTTTACTTGGTGGTCCGAAAGTTTCGAGCTACGACCGATTCTGCAGGAGGTAAACTGATTCTAGG
GATCGATCAGCAAATCTCTGTCGACTGGGAGGGACGCGACGTTGCCGAGTTTCAGAGCTTTGTCGATGTGCTGCATGGGTGTGTTGTGATATGTATTGGT
CTCATAACGTGTTGCCTCGTCTAGTCTAACCTGCGATGTGTACCATAGACTGCTGCTTGACAACGAGTGGGATGCTGCTGCTATCTCCAGTCTGAATAAA
GTCGTGAAGCGAATTCAGGATCCTCGGGCTCGCCAACGCTTTCTGACGTTCGCCTTCCAAATACTCCGGCAAGCATCGCAGAGTAAGGCTGCACGTGCGG
GGTCATCGCCACCATTTGATGTCAAGTTCTTTGATGAAGCAGTTCGGCTGCTGTTACTTGGTGTGACCGACTTGTGGTCTGCAATCCGGAAGGACTGCGC
GAAGAATGCAGCAGCCATCGCGTTTGAGTTTCCATCCCTAAATCACATCGAGCAGTTTATGGACAGTTTGCTCGGTGTCGCTGTCGGCTCCCGAAGTGTG
AGCGCCGACAAAACCCAAGTGACAGCGTGGACGGAGCGAGAAGGAGCTTTGTTGGCGCTGTCAGATCTTCTGCGCTCCATTAAAATGGACTCCACATCTC
CACAACCCGAAAACCCCAAGACCTCTCAGGTTAAAGAGGATATCAAGGGCATATTGGGCGTCCGTCAATCGCCAGCAGTGAGATATCGACTTGGGCTGAA
TGAGCGCCACACGTTCACTCAACTGCCGCGATGTCTAGTACAAACGCTGAAGCCAGCCATTTATCAGTGTCTTCGTCACGACCAGCTTACTGTTCGGCAG
CTTGCGGCCCGATGTTTGGTGGAATATGCCGCACTTTGTGAAACCCCAACACGGCTACTCATTTTCCAGGAAGTGATCAGCAAGTTAAACCGCATGAACC
GCAATGACAAGGTCGATGAGAGTGACGGTATCGCGAACACCAGCGAGTCAGAACTTCTGGATGCGTTTGAGGCGGAAGGCTTACTGGATGTCCTAGCTCG
GATGGCTCCATGTCTCCCCTCACGCTTCTTGTTAAGGCACTGGAAGTTCGTATTTCCAACGCTGGAGAAATACGTCATGCACATCGCATCCAGTGTTCGT
CAAAAGAGCAGCAGTGTCGTGTTGGCGCTGGCAAAGCTTGGTTTGAGCGGTATCCAGCAAGGAAAGTCTGTGGATGACGAATTGGAGCCAAGCGCAAATT
CGGCCTTTGACGAGGCCTCCTTGAAGCTGATTGAGCAGATGTTACTTTCTCTGTCTAACAAACGGAGAGATGCAATTGATTTCTGTTGGCAACAACGAGA
AGGTCGTCTTTTGAGCATTGAAGTCCTTATGAACGTGCTTGGCGAAAGTCTTGTGACTTGTCAATCCAATGAGTTGTTGAGGTGGAAACCGGTGCCTACC
AATCTTCGACAAGGACGATCAACGTCTCTTTCCCACTTGCAAGCAGTTCAGTGGGCACACGATCAAGCTCAGCGGGCGACATGGGTGCTAAATGACAATG
AAGTAGAGGAGGAACCAGAGAACCTGTCAATTGTCCAGGTTATTAGCGATTGGGTGGACACGCATCGTGGCCAAAACGACCTACCTGCTTCAAGCCAAGG
ATTTTGGCAGCAGATTCTGAGTGGATGCATCGCTCACACGAAAGAGGCATTCGAGTCCTCACAGTTTGAGCTTCGCAGAATCTCTCGGCAGCTTCTTCCT
GGGTTAATGAGGCTAATTGTTTGGACCGATCAGCTGGAATTTCTCTCATCTACTGAGTTTCAGAGCGGTTCTGCGGACACATCGTGGTGCTGTGCGTGTG
CGAAGTTCACTTTGCTGCACTTACGGTACTTGCAAGAAAGTGTGGATGCCTTAGGTAGCTGTGCTTCGAGTTCTCTTTCGCAGAAACTAGTAGAGGATTG
GACAATTGTGTGGGACGGCATCGCAGCAATGGAAATGAATCCGGAGAGCTTTCCGCTTGATACAGAAACAGCAGTGGGGCAAGTAGAGATTAGGCTTTTA
GCGTTCCTTTGTTTCGGAGGAACAGCAGATCCACCTCGTCAGCTAACTCAGCTTTTAGATGGCGCGCTACGAGCGATGCACGCAAATCTCCCCCAACGTC
TGCAGCTAGGAACGCAAATGGGAAATACCGTGAGCGCCAATAGCTCACTGGATCGTCAGTTCAGCATTTTCTTGGTGCCTATGCTTCCGGTCGTTGTCTC
GACGATGCACTACGTGGCTGAAACTATGGATTCAACCGCAAAAGATGATGTCCAACCACGTGACTTTGGCCTGTCGTGGTATTCTCGATGGCTGTGTTTG
GAGCGCATCATTCTATCGTGGCTATTGTGCAACGACATGTTTCGCTGGATCACGATGAACAAGTCAGAGGCTCAATCCAGCCTCTTAGAAAGTCTTAGCA
TGCTACTTCATTCCCCGAACTCTCACCAACTATATGAAGAGTTCGACAAAATTGTTCAGTGCCTCAGTGACACCTTTGGTGCTCCGCAGACCAAAATCAA
AGACGCAACGTACACCAACTTGCTGGATATTTATCTGCAAATGTGGCTGTCATGCACTACTAGCGGCAACCGCAGCAAGGAGAAGCTACTGGTTGCAATT
GCCAGTCTTTACAGCCAGCGACAGCAGGCCCTCACCGTATCTGGTGTTAATGGAAAGCAAAATTCAGCGCTTGAATCCTGGGACAACTGGGACGAGGAGG
AGGAAATTCAGCAACCATCGCCAGTCGGCGAGATGCAAGAGCCCAACGGAGTGGCTAATCAAGACGCCCTGTTTCAAGAGGTGCTGAGAACGCTCGATGC
AAGTCAGCTAACCTTGCTCCACGAGGCAGCGTGTGCCACCCCAGGCCTAGAAGGTGCTGGAGACCTCTCTTGTCAACACGTAACACGGATGCAGCAACAG
ATCGAAGCTTGTCTGCAGCTATAGTCCTCCACAGCGCAAGGTAGTGCACACATTCAACAGACAGATCAGTAGCATATTCATCATAGCATGCTGAAATCTC
CAACTGTATTCGTTGCGCACACTTTCTAGTCTCCAAACTCCAAATTCAAAGTGCTGAGCTCCACCAAGTTCCACATCCACACGCAGTGCGCCAGGGCTAA
AATCACGACTACCACTGACAGCGCGATTTCCCAGGTCAGTATTTCTTCGAGCATCCCCATCGTTCTTTCCTCGCGATTGTCAACTCCAGAGTTCACGGTC
TCCCTTTCGTATACTTCCGATGGCTCTCTCTCCGTTTCATGTAGTACTTCGGCTGGCATCTTCCCAGAATGTCGAAGTTCTTCGTCTCCGCTGCTTTCAT
CCAAAATGCTTCTCTCCGGCTCGAGGTCGCTGGAACCCAGCCTCCTTGCTCGTGGTCCGTCGCTAGTGAAGTAGTTCGTGATGATCTGCTTCGACAGCGA
GGCTTCTTCATCAGGCAGCAAGATGGTGGCGTCGAGAGCTTGGTCAACCTCGTCTTGCTGCATGTCCAAGTCCGTTTTCCTTCGAGTTTGGTGTCAATAC
TGCTCCTGCGGGTCGAAAGCCGTCAGTTCCAACCGTCGCGTTGCCGGCATTGGTGAATCCGCTTCAAGATCCTTTTCCCAAGTTGAAGTGGATCTGTTCG
TCGACAGTAGTTTACGGGTAGCTCATCGCTTCCGTCCCGTTTTCGTGACTGGTGCAGCAGCATGGAGGCCTTGAGCGCTGATGCTGCGTCGCAACGCACG
CTCAGCTTCGTCTGTGGGTCGTGTGGTGATGACGCGGCGTTAGCAGTGCCGTTGGATAAAGTTCAAGGTGCGGTGACGGCTGTAGAGCCGAAGTTGAAGC
GGCGACGCCTTGGTGAGACTTCCATCGTCGACGTGCGGCTTGTCGAGCTTATCCGTGACCTCGACGAGGCCAACGAAGACAATGACAAGCACTACGGGCT
GTTTGTGTGGCCGTCCGCACTTTTGCTGTCGCGATTTGTCGCCCGCGAAGTCGACTCGCTGTGTCGCGACAAAGTTGTGCTGGAATTGGGCTGCGGCACT
GGCCTCCCGTCGATCCTCGCTGGGTTGTGTGGCGCGACGAAGGTGTATCTTACCGATCGACCCGACGCTGTCGACGTCCAGCGCAACGCAGAAGTCAACA
TCAAGCTAAACGGTCTCGAGGATCGTGCCCAGTTCATTGGACTCACCTGGGGCGACATGCTCGTACCGGACAAAGTGCTCGCCATCTTCCGAAGCGTCCA
AGTCATCCTCGCCGCCGACTGCTTCTACCAGTCTGAAGGTACAATCGCAACAGAATCAACTGTAAAACCACATCTAACTCCCTCAACTTGCAGATTTCGA
GAAGGTGCTGGCCACCGTCGCTCTCATCTTCCGCTGCAGCAATTGCACGTCCTGCCAGTTCTACTTGTCGTACCAACTGCGAAGTATCAACCGATCAATC
GCGCCGCTACTTTCTCGTTGGGGGTTGTCTGCTAAATCGGTCGACAAAAGTCAACTCGTCCATGTAGACGACGCTCAAGACTTTGACAGTATCTACCTCT
ACCAAGTCTCAACATGAATTATGGAATTGGTGGCTCAGCTTCGCCTTTTTTGTTTCTCTCCTAGTTCCTCCTTCTTAAAAGTTTGTTTTTCCAATTGCTG
GAAACTGTCCCTCCCACCATCTAGAGAACATACGCGTGGGGCTCTCGCAGTAGCCTCTTCAGCCTTTACAATGGGAGATTCGTACTATTCCCCGGTCAAT
TGGTGAATCCTTCGCACGAGTGAGACCGTGGAGCTCTCCTGTCCACTCGCAGCCTAATAAGATCCCAAGATGCATCTAAAACCCGGGGGGGGGGGTTGTC
GCGGAACTCGAGAGTCAATCGTTTTCTCATCCTCGCCACCAAAATGCACACACGCAACGAAGAAAATGTCCAACCGCAACGAAGAAAAAGTCCAACCGCA
ACGAAGAAAAAGCCAAAGTGTGAGTTCTTCTTGAAAATGGGGCACCGCAGCGTGCCCTTCGCTCTCCTCATTCGCTGAAACCCATTCTTTTCCGCCAATC
ACACGCCATCTAGTATGTGGCCAAGCTGCTCCACCGCACTCTCAAATCTTCCAGGACGAGATCATGTTCGCCCGAGTTGCTCGCGCTGCTTCATTCGCCG
CCGTACGCCGCACGCCCTCTGTGGCGCTGCGTGCCCTGCAGACCCGCGAGAAGTCGACGCTCGTGTCCATTCTCAACGTACGTCATGCAACTCGTAAAAT
TCCGCTCGCAATCCAGTAAAAACCGCGTTCTAACCTAAAACTACCTACTTCTTTCCTATTGCAGCGCGAAGTGACCGAGGAGAAGGCCAACTGCTTCGAG
GAGCCCGATCTGGAGGCTCTGCGTCTCAAGGTGGAGGAGGTGTTCGCCCTCAAGGAGACTCCTGGCTGCATGGACGTCCTGCTCGAGGGCTCGGTGGATT
CCGAGTCCATCAGGATCAAGTTTAATGCCCAGGACACTGTGGAGCTCGAAGACGACGAGGACTACGACGAGGATGAGGACGATGAGCAGGACGACGAGCA
GGAGCAGGACGAGGACGAAGAGGAGGAGGACGAGCTCCCGGGCGTCCGCTTCACGGCCGACGTGACCCGTGACAACAAGGGCCTGCAGTTCGACTGCGTG
GCCAGCAGCAACCTCACGGTGGAGCGCGTGCGCTACCTGAGCGACTTTGCCAAGGACGCGGAGGACGAGACGCTGTACTTTGGGCCCAACTTCATTGACC
TGGAGCTCGACGTGCAGGACAAGTTCTACGGCTACCTGGCCGAGCGCAAGATCGACGACGAGCTGGCGCAGTTCATCGCGCAGTTTGCTGATCTCAAGGA
GCAGCGCGAGTACCTGACCTTCCTCCAGGACGCCGAGAGCTTCGTCAAGCACTAAACCCGTATTGCTGCATACCGTACAGGCTGCTTGAGGTTCGTGACG
ACCACACCGCACACAATAAACAGTTAGAGCCTCACTCACCACTTGCCATTTACAGTCCTCGTATCGTCTGCAAGCAGTAGAACGGCTGCGTCGCTATTGC
TTGCTGTCCTGTCTAACCTTGCATCCCAGCCATCACGCTCTGCATGAGCTGCGAGACCTTGGGGTTCGACATGTGGCGCATAGCGGCCGACGGGCCTTCG
GCGTCCACGTCGCGGAAGAAATCTGCCAGGTCCGGGTCGGATCGCGCCGCCACGAGCTCAGGGCTGTTCATGAGGCCGCTCATGTCGGGCATGCCACCAG
CACCAGGGCCAGAGGGAGCTGCACCGCCAGCACCACCGCCGCCAAGGCCGCCCATGAGGCCGCTGAGCATGTCGGGGTTCTGCATCATATTCTGCGCCAT
CTGCATCATCTGCGGGTTCTGCATCATGCTTTGGGCCATCTGCATCATCTGCGGGTTGTTCATGAGGTCGCCGAGGCCACCGCCACCTCCGCCCAGCATG
CTGGCCAGGTTCGACAGGTCCGGCATGCCACCAGCGCCACCAGCAGGGGGTGTAGCTGAAGAAGAACTCGTCGTCTGCACTTGGCGGCGCTTGCGCTCAG
CATCTGCAAGGCCGTCACGGCAAGCAGCGTTGGAGCTGTCCACCTCAAGTCCACGACGGAACGAGTCGATAGCGCCGTCAAAGTCCTGCAGCTGCAGCTG
CGCGCTGCCCAACCGGGAGTAGGCCTTGACGTACGCCGGCTTGAGCACAATCGACTGCTCGCAGTGGTCGATCACGTCCGTGTACTTGCCCAGGTACATC
AACGCCGCAGCCAAGTTCGAGTGGTAAATGTGCGACGACGGTCCCTCTGGTGACAGCTGCAGCGCCTCTCGATACAACTTGGCAGCTCCTTCGTAGTCCT
GGCGACTCAGAGCCGCATTGCCCTGGGCCTTCACCTCCTCCGCCTTGGCCTCCTTCTCCTCCTGGGAAAGCTCCGGCTTCACATCTCCGAATTTCTCCTT
AAATTTACCCAGCGCTTTGGCCGTACGGGTAGCATGTTCACTGGTGCCAGGGGCCGCGTCCTTGAAGAAACCCTTGGCTTCCAGCTTGGCCACCCACTTC
TTCCAGAGCTCCGGGTCTGACAAATAAGAAAAGAAGCAGCCAATCAGCGCTCTCCTCCTTCTCTTATAAAAATCATCCACGTACGCTTTTTAACGACAGG
ATCTTCGTCCACAGCCTCCTTCGCGCCAGTCTCCAGGTTCAGCGCCTTGAGCCCCGCAGCAAAAATCTCGTTGAATGAGATGTCGCTGTCGACCGCCAGC
TGTCGTCGCTGCTCGGCGTCGTGCACGTCCACGCCGAAAGCCTCACTATGTGGTGGATAATGATAAAAAAGAAGTAAACTGTTACGTTAGAAAAACACAT
CATATCGAGATTTTGCAGCTTGTAGGACCAAGCAAAATGCTGAAATTACGTGAGACGGGAGAGCGCCGTGTCGATCTCCTGTGCATCCACGCCTTCACGC
GTCTTGAGCGTGTCCACCCACGCCAGCGCGTTGAACAGCGTCGCCTTACTCGCCTCGTCCATCAGGTCCCAAGTGAATCAAATTCTCCCCTTGTTCCACC
AAATGAAATCCTTTTAATTGGTTGGAAATCCATCTCTTTTCTACCAATAAAACGAAAGATCGCACCGCTTCAACTACAGATGGCTACATTTTGTATCAAT
ATGGAGGAAGAGGCGCTGGCCGCGAATGAGGCGGCGATTCTGGAGCGCAGAGACGAGATCCGATCCAGTTTGAGGGCGGTGGAGAACTCTCTGAGGGAGG
CTGGAGCTGTCACGCATGGATACAATAGCGCGTACCTATTGGAGTCGCCCGCTACCCATTGGAACCCGACCACTTCCTTGTTCCGACGGACTGTGGCGAG
TTTGACGAGTTCTGCAGCGTTTCGCTTTGGTTTCGACGCTCCAGATGCAGTTCGACTTGAGTGGAGACTGTCGCCGTTGGGAGAAGCCAAGTGTCGGAAG
ATTTGGACCCTTTTTGACGCAGACGAGGACGAAAGGTGGACACATGAAGAGTTCCTGGAGTACATGGCGGCGTTGCAGTGCTCGAGCGATTCAGTGGAGT
TGAGGGCGTTTGAAGAGAGCTCAGAGGTCTGGGGAATGTATATGAGTGATATGTGCGAGCTGGACGAGGAAGGGAGGCTTACGTTCCAAGGGTTTGTCAT
GTACCGAGAGCAGATTGAGGACGAACAGCCGTTGACACGAGATTTGGCGTCGTTGGGGATTTCGTTGGAGTGGGAAGAGCTCGAGCGAGTGGAGATGATG
AAACAGCTTTTTGACGCGTATGTGGATGATCCGACGGGTTCAGTGACGGCTAAAGCTGCGCAGTATTTGCTGGCCGAGAGTGGGTTTGTCCTAACGGGCG
ACGAGACGGCGGAGATCATTGGCAAGAGATACGAACTCGCACGTTGTCTGAGGTTTATACACCAGTTGAAGCGTACTTTGCGTTTGTTTGGATACCGTCA
GAAGTCGGCTCTACGATTCACGAATGAAGGGCATGCTCGAAGTGAGCACAATGAGGAACAGCCACGAATCTGCAAGGTTGGGTTTCTGAGCTTGATGTCC
TCTTCCTGGTGTCCGGCTGTGAAAACGGTAGGTACGTGATTAGTCATTGCGTTTTCTGCTACTTGGAAGCTGGTTCTGTGCTGATAGAGACGTGGGTGTG
GTGAAGCGCTGGCGCAGATTCTTTTTGCAGTGCCGTTTGCATTCCTTCTGCGCATTGAGACGACTCAAGCAACGAGTTCAATGGATATTTAAACATGTGC
GCCAAGCAGCGGCCACAGGGCTGCTGTCTGCGAGTTGTCTGCTGTCTCGCACTCCTGGCGGCGATCGAGGCGACTATATGGTGAAAGTTGACGTAGGGCA
CAAGTTTTCTACAACCGCTACCGTTCATCTCACTTACAACTCGGACGCTGACTGTAAGTGATTTTTGTTGTCTTGAGTTGGGAGCTGACCTAACCAGATA
CACTATGCAATGTGCAGCTGCTGCCACACTCCACGAGTTGAAATATCTGGAGCGTGGTGCAGAATGCTTCATGTACATCGACTTCGCCTGTCGGAGTGGC
ACGAAAGGTTGGTACATTTGCTGGTACTGGCAACCGTACAGGAAAAATCTAATTAGTTTGTATGTGGCTATCTTACTGTAGACAGCGACGCTCAAATTCT
AGTCGATCGTTTAACATGGTTCTTGGGCGATTTTTTTCGCGATCATATCGAGTCGCTACCGTTCTTCCACCGTTGGTTTGTTACACTACCGACGAAACCC
CAGTTACGCATGGGGCCATCAAGCAGTGGAACTCCTGGACCGTCATCGCCAGTAGTTCGACTGGTGATCCTGTTCACTGGAGAGATGGATTTGTATCATG
TGATGCAGTCGCTAGGTTTGCCGTCGTCCATGCAGTTTGACCACCTTTTGCAGCGATTTTCGCTGCGCTGGTTGTGCAGCCATTCACTTGAGGCCCTCTT
GGTAGCCAAGAATCTCAATCTTGGTTCCCATTGGTCCTGTCGAACTCAAATGGACCTGCGGCTGAATCGGCAGGCGTGGGCTCAAATTATCTCCCAGGTC
GCGTATCAACTCGAAGCGGACCTGGCTCATGAACGCGAGGACGCGGAGTATATCGCACAAGTCAAGGCCGAGCGTGAGCAGAAGAAAAAGAAGTCGGTGG
TGCTGAACCAACGACGTCAATCGGCATCAACACAGCCAAATAATCAGCACGACAATCTGCATAATTCTCAAAGCGAAAGCTCTAACGCTGAGAGCAGCCA
GCATTTGCTGATCAAGTCGCTTCATCGTGTCGCCTACGCGCTCAGACACTCGCAACAGCTGAGCTCAGCGTGGGCGTTTACAAACTTGGGGGCCGCACTT
CGGGAGAACCAGTGGCTTCGCAGTGTCTTATCACCACAGTGGCTTGAACTACTCACCCACGTGCTAGAGACCCCAGGAGGACTTGCTGGCGAGTGGAAAG
CTAAAGGAGACTCGTTGCGAGCTGAATTTGCTGATACTAGCTATGCTATGGCTGGTGCAGCTCGCCAGGTGCTAGGGCACCATACACTGCGGCCAACAGG
GTCTTCAAACGAATTTACCCTCGCACCTTTCGCGGCAGCAGCAATGAAGAACCCACCAACGTCGAGAGTGTCCGAGACACCAAAGCTAACAGCACGGCAC
AGTCATATTCAACATGACCCAAATCATTCTACCAACAATATTCCCGAAGCACCCGAGGAGAAAAGCACGGAATATCTGCTGCTTGAGTTCTACGACTTGT
GCGCTCGGCATCTGCAAGGAGTGCGCGTTGTGCGCGCTGAGGCCGGGACGAGTGGAGTCACGTGTATCCTTGAAGGATGGAACATTTTCAGCTTGCTGCC
AAGAATTCACCAAGGTCACCTTATGAAGAAAGCGTCGCTGGTTCGATCCGGCACTTTTACCTCGTGGCAGCCACATTCCAGTCGAAGTACTAGCTCAGGC
ATGGGGCATTAGATCAAATTTTCCCCGTGACACCACTTGATTGAGGCGCGTGAGCCCCTGGATTTCAACACACCTACACGTGGCCCCCGATGATAATCGA
TGCTGGCCCTGGGATATGATCAAAACTCCAATACTGGGGTGTTTCATTTCTGTTAACATGGGCAATGCAGACAGCGCTCAAGCAGATCAGACGTTGGTCT
CAACAGAACGGTCTCCTGGAAAAGATAGTTGGTACTGCCCTTGAAAAAAAAAAAACAAGGGCTTGATAAATCATCAGTTCTGCGGAGAGGCTGCACACTA
CACCCATTCACAACTTGATCTAACATCCTATAGCACTACGCCATAGGATTCGAAGGAGTCAGATACGGTCGTTGACAGTCAGAACAACTGCACCCCGGTC
GCAGTGTTGGTACTGTGTTTCGCTTCATCACTCTCCAGGCTTGAAAACTGCGCACCAGTACAACGAGTGATCGAGTGAAGTCACTTCTGGGGTATTCTCA
ACAGAACAACTGTCGTGGGGGCCAGTGTTGGTGCTGTGGGGTAGGTTGGCTGGAAAAATATCGTCGCTCTTCAGCATCGACCACTCGCAGCACAATATGC
GCTCGATCACTACTGGAATATACAGATATTGGTGGGTTGGCGGATGGTCAGTGTAACTATGACAAAGTGTAATGCTCACAGAAGGAGGAGAGACCAAAAC
GGTCCTCGCTCCTATCACTATGTAACGTTAGGTATCTTCACTCCATCGCCAGCGCTGTAAACGCTATAATAATGCACAAAACCGCTTCTCATTCAACTTC
TCGTCCACAAAGCAAAATCGATAGTGAACGCGGTGAGGCAGTGGTCGCGAGCAGTTTGACTTTTGACTTGATGTTTGTATGTCAAGTACAGTAGGCTGAC
TGGTCAGCATAAGCCGACGCTGATTCGACAAAACCAGCGAGTTATTCTGATTCGCCAAATAAACTCAGCTCTGTAATTGGTCAAAACAAAGTGCATCATG
ACGGAAGATCGGCTGCAGGTGCTGGACGTTGACGTGTGCATCGATGGCCCTGCACGCATCGGAGCAGCGTTCCAAGCGGGTGACAATCAAACTATTGCAG
TGTGCGACAGGACCCGCGTAATTGTGATCGCTAACGGTCGCTTCATCGACTTGTACGGCGCCTGTGCCAACAGTTCGCATCCCTTTGCGTTCCTGCAGCA
AATTTCGATCGGGGAGTACGTAAATCGCTCACCAAAGAGGCAAAAAGTCAGCGGTGATGCTCTGGATGTGAATATTGTGGTTACCACGTGTGTGGTATTT
CCCGTTCCCGGTTTTCTGCTGGTCGGGGCGTTCGTGGAAGCTCTGGAATCTGACATTTCGAGAAATGGAGAAGCGGTTGAAAGTCGTCGAGAGATTTTGC
TGCTTGGGTTCCGTTTGTACGCAGGTTCTGCTTCTCGTTTTACCGGTGATATGGGTGGTGAGAACGTTCGTCAAGGTTCAGCGTCGGTGCAAGTTCATTT
TAGTTTCGTGGAACCGGTGGTGGGGATTTCTGCAGGGGCCATTCGACGTTTGCAGCCATTTCGTCTTGACATGACGCCCGATACAGGATCTGTGGTGGTT
CTTATTGATGGCTGCAAATTGTTTGGAGTTTTATGTTGGAAAGAGCGATTTAGTGATCGCCAAATGTGTCTAGCCCGACTGAAGCAGCAATCGGAAGCGC
TGGTTGCTGCTGAGTGCAGTCCTGATGGTCGATATCTGGTTATTGGAGACGCGGAAGGACGACTGTCGCTGTTGGACTTTCGTGATTTTTTGTTGGATGA
TCACGAGATATCTTCAAGAGTACAGCCGAAGTTGGGAGGCAAGCGACTGAAGATCGAGGGGTGCACTCGCTCTGGAGTCATCACGCGCGACAGTCCTCTC
GAAAACGTGCGGCTTGTTCACACAATAACTAGCTCTGGTACCAATTGTGCATACACAAGCATGCGTTGGTGGATTACCGGTGTGGGTGATCAGCAGAAGC
AATTTGTTCTGGCTGGGAAACAGGATGGATCATTGAGTGTACGTGGCTGCAACTCATCCGGGTTTTTATTTAAGAAGTGACGCTGACGCGGAAATCTGTA
GGTGTTAAAACTCGTCCAAGAAAGCGATAAAGTAAGCTCCATCATCGAGCTGAAGATGGTCCAGGTTTGTTGAGTCGTGCATCTGTATCGAAATTGTCAT
TCATATCTAAGTGATACTGGCAGTTGTATCCAGGCTTAGCGTCGGGCACACATGACGTCGTTCGAAGCATTTCTGAGCCGACGAAGATTACTGCACCGAA
CACAGCGGACGATACCTGGCTCGAGTTTTACACCATCTCGGAAATGCGCTGGAGAACTTGGCGGATAAAAATTGCAGGAGCTAGCGAAGGACTGACCAAG
CGCTATCGAATGATTTGGCCGTCGGTAAAAGACTCACTTGACTTCCCGGCATTCATGGTGAGCACACTTATTGGCGCTGGTAATCAACCTGCGCCTGCCA
TTTACCGACCTAACGTTGTGAAATTTGATATGGGCGTGCAGATTCGAGCCAAGACCATTAAAGGAATCGCTATGCTCTTTAGCCCTACCGAATTATCGAA
ACTTGTTGCCGCAGCACTCTCAGATGCTATTCCAGACCACGCGCCTCGGTATCCGATCTCGTTGATGGTGGCAGACAACCGTCTGCAAGTGGCAGGGCTA
TTGACTACGACTCCTGTCGAGGTCTCTTCGGAATCTGAAAGCAGTCCAAGTGAGCGCAATGAGTGCGAGAATGGCGATGGAAAGAGCGAGCGCGAGGTGG
CTACAGAAGACTTAGCCGACACAAAAACAGAGAGGATTGAAGACAATCAGTCCTCAGGCCCCACTACAATCCAAGACAAGTACAAGCTTCCTCCGATGGA
GTGGAAATCCAAAGGCTCTACACCCGGTTCTGCCAGCCAGAACGGAGAGCGAGATGAGGCAGGCAACAATAGACGGGTATCAAAGCTTAGTCGCGTTGAC
TATGACAAGCGAGTTGCTTCCGTCAAGCAGCGCGTCGAGACTCTTGGTGGCGTCATGAAATCGATGCGGACATCCTTTCAACTATTTTCGAGTGATGTCC
AGCAGCACATGAATCTCGTTTCCGAACAGCTCGAAGAAATTAGTCGCCGACGAGTCACACAAGAAACTGCCCAGGCTTCTCGAAACACCTGAATATACAC
TGGAGGATTATTGCATCAACAGAGGAGGTCATGGAGAAAAGCTTCCTTCAAGCGCAGGCTGAAATGACACGCTTTGATGCTGGGACACGACCTCATGAAG
GCGAAGACGGGTCCAATAACCAGAGGCCATCACCTGCCATCCCGTATGTGGCGGACAAGTACAATCCTGACCATCCCGATGCTGACTGGGGAGGCTACGT
GCGGCGGTCGTACAAGAAGCGCTTCTACACGAATCAGTCGTCCGTTAAAGATGTACGAATTCCTATTCTGTTTGTCCGCTGCAACGTATTGACTCGGCTG
TGCTCATCCAACCAGAATCTAACCAACGACGAGAAAGGCGGCATCATGCCGCGTGGCTCGGCCGAAAACTCAATGACGTCAGGAAAGAAGCTCTTTGAGC
CTCAGCAGGGTGCATCGGGCGAGCAAGTTCCAGGTATCCCCTTCCAGAGTGCTGTTTACCAGGTAACGGTTGCTCCCGACCAAATTCCCTGCTGAAGGAA
CCTCAGTCTCAGCTTTATCTGCAGGTTGGACCTGGGAGTGATGTCAGTTGCAGTGACTGGAAAACGTAAGTGGAACCGGCTGCAAAGAGGCAGACATTGT
GTTCACACCTCTATATTCTGTTACCGCCGTATTTCCTGTATCTACAGATCGTATGCGTCCCAAACAGCGATGGACGCGACGTCTAAAGACAACTATGTGC
TTGGCACGCGGCAAAACTCGCAGCACAAACGCCACGTGACACCGATGGTAAGTTATCATCGCCATTTTTCACACGGATAAATGCCAACGCTAACGCAATG
TTCGGTGTCTGTGCTCAGTATGAGCAAGGGCGTGGGGTACGTCAAAATTCGGCTCGAGCTCAATCCCCTTCATGGGAAGGGGGTCCAGGGTTGTCAACCC
CGCTAAGTGGGAGTGGGAGCAGCGGATCACTTTCTGGGCGCCGTGTTGATTCGCGTCGATCTTTGCTTGCGGGTATTGGCAAACTCGTTGCAGCAGAAGA
CCTTAATGGAGCTCTACCGTGAGTTCGCCGCTTCGAATCCATCCACATCAGTTTCTAATCTGTCGCTATGCTCTTTGCAGACCACCGGAGAGACACCTAC
CAGAGAGCTACACAAAGCAAGCATCCAAGGCTCTGCTAGCAGAAAACTAGTGAGTAATGTTAGATTGTTGTGGATCAAGCTGGTTTTCTTAACCTTTCTG
TGTCTGCGCAGCCATGGGACAACGTTAGGGTACACTGGTCGTCGAAATATGCCTAACTACTGAGGGGTAGACGAAGATGTGGGTCAAACAAGTAACTAGT
TAAGAAAAAAGTGGCGATGAGGCGTCACCAGCTTGTGTTCACTCCTCAATGCGCTTTACTTACATGGAGCGCATGTCAATTCGTAGCGCCATAAGGCTAA
TGACCGCGCCCAGGAACGAAAGAGCACCTCCCACGAACACTGGCAACGCATACCCCATCGACGTCTCCACCAGCGCAGCTCCCACCAGGAAATTGAGCAG
TTGGCCAATGCAGTTCGCCGAGTTCACTGCACCGACATACATGCCGACATGTGCAGAACAGCCAAAGACGTGCACGATGATAGGCACGATGAGAGCGAAA
ATCGTAGCCTGGGTGATGGCAGTGAGGGCGACGATCGCCACGTCCAGAGCGACAATCTTCGAGAACGCCATAACCATCAGTAAAGCCTGCGGGATGCACG
CGACCGTGATGACCCAACGCGCGCCGAGGTGATAAACCATGAACGGGAGCATCCACGAATACAAATATCCGAGAACATTGAACAGCAAGTCTGCGAGGCC
ACCAGCAATCTGCACACCATGATTGTAACGCTCTTGCGCTGCTGTGCAGAGAATCGGACCACAGTTGTCTGCATCCGTCGAGTTACCTCCGACAACCTCG
ATGCCAAAGAATTGCCCCTTGTTGCCGTTGTAGGCTGTGAAGCCGAATTGGATGCAGAAAAGCACAAGGCAATAGATTGCCAGCGTACGGGGCAGCGTCT
TGAGGCCGTGAAAGGTGCAACAGAATGCTTCGCCAATGCGCTTCAGTGCGCTTGGAGCTTCTTCTCCTGGGCCCACCTCCAAATCCTTTGAAGCGGGCAC
TTGCTCCTTGACAAACACGCAGACAGCACCCACAGAAGCCAGCATGGTCGCTGAGAGCATGCCGAGAAACCAGTGTAGCGTCAGGTGGGCGGCACCAAAA
ATGTAGATGTACCCGGCCACCAAGATGGAGCCCAGCGTTGAGCTAGCCTGTCCGATGCTGGCCCCCAGAGTCTGTCGGTCTCCCGCAAAATCCGCAATGA
TGAGGAATGCTGGAGTTTGAACGACATTTACCGTGATGTCCATCCAGGTGTAGAACAGGATAGTAAGCCAGGCTGTGCACGGACGAGACTCGTTCCCCGA
GTCACCAAGCAGTTCCCCCAACTCACGTGTATATCCCATCAGCATCCAGCACGCTGCACTTGTCACGGCTCCATACATCAAAAATGGACGGCGACGACCC
CACTTGCACGAGCTGCGATCACTGAGGACGCCGATTGCTGGCGCTACAAGGATACCCGAGAGTGGACCGATCAGCTGCGTAAGCTGCACAGCAAAAGGTG
GCAGCATCGTTCCGAGGTATGGACCGAGAGCAGCCCATTGCGCCGACCAAGCCATGTTGATAGCCATTCGGGGCAGGGAAAGCAACACGAGCATGGGCAC
GGAACACCCAGTCGTGTGCTTGGTCTCGCCAGCGTCGCTGAGGTCGAGGTGCGAGAACGTAGAGAACCTCGGAGGGTGTTCCGGCAGCCCCAGAACAGTT
GGTTCCCGGCGAGGTGGCGACTCTGCGGGGTTGTAGCTTGGGGTAGTTACTTCGATGATGGCGGTCATGGCGTCACAAAATCGACTCGCGGCAGCGTGTG
GATCCAAGCTTGCTAGACGTGCAAGAGCAGATTCGCAAATGAGCAGACCTTGGGAAGCTGGACACCACGGCTGCACACTTTTTGGCATTGACCCCATGAT
TGACATGTTCAAGTTCAACGATCCTTTTAGTCTCACAAATGTACGCGAGAGCGAATCGTGCAGCAGCAGAATTCACGCGATCCCCACAGTCGTGCCGTTA
TCAGAACCACCTCTTATAGAAGGCAACCATTTTTCTTTGTCTCCCCAACGACGGAAAACTAGAATCGAGCGTCGTGCGGCGTACGAGCAGTCTTCAGCAC
CACTCCAGGCTGTCATTTTTCACCGATAGTTTCTCTCGTGTGTTTATATCGCAGCATCATTTTTCTTGTTGGAATCACAAGTGATCGAGTTTGCAGACGG
CAACGTGTACATGTGGCAAAGCACACACGACTTTTACCTATTGAAATGTGAACAATTATGCCGTTGCATTGGGTTTGTTCCCGCGCTCTCGCGCTTCCTG
CATCGCCTGCCGCATCCGTTCCTTTGTCCGTTCCTTGAGATTCCTGAAAAACGCCATATCGTCCTGCAATTCCACCAGCAACTCATGGTTCATGCCAGTC
GTCTGCGCCTCTCGAAAAGCTCTCCGCAACTCCTGCAGAACCTCCAGCACCTCTTTCAGATGGTGCGTATCTCGGTCTCGTTGCTCCGTCATTTTGTGCC
ATTCCTGCAATTGCATTTTGGTCTTTCCGAGCCGAATGGACTCCATCAACTGCTCTGTGACTACCGTCCTACAGCTACCGCACAATTGTCCATCGGCTGC
CACATTTTGAGTGTACGAGTTGGCGATCCCACTCAGAATTTCCAGATCCGTCGTTGGATTGGTCGAGGACTTCAAATTTGGAGGGTACTGCATGGGCAGC
ACGAGACCAGATTGGGCTCCTTCGTAGAACCCTTGTAGCTCTCCATTGTCATTCTGAGTCTGAGTCTGGATCGTCATCGTTGGAAGTTTCCGTTTATTGG
CCATGTTGTTGACTATCTGGGGGTCAGTATCCCCAGTGTTGCTGTCGTCGTCATCTTGAGCCTCATCCTGGCCTCGCTTCCCCATTTGGTCCTCGCGGAG
CGGTGGGAGCCCATTCGGAGGCCCATTTTGGGAAGTACCGTCGAATTTGCGCAATAAGTCAATGTACCCACTTTTGTTATCGTTGGCGTTCGGACCCTTT
TTTATGGGTCGGAGACCTCGCCGGTAGCACTCCGCACGCAGGTCGTGCGCGCGGTGGCGCTCGTACGGCTCCTGCAGCCGCCGCATCTTGCCCTCCACGT
CCGCATCGCTCGACAGCAGCGAGTCGATGTCCCCTCCGTTGCTGTGCACGTCGCCTAAACCGCCGCTCGCGTCCATTATTCTAATTGGTGTGTGACCACA
TCATGAAACATGAAATCATTAAAATGGACACCTTGAAATAATGACTTCAATTTGCGAACGAGAGTGATGGTCTCATAGTTGAGGAACGGCATGCAACGGT
GAGGACGAGGTGCCCGCTAAAAATGGGGTAGCGACAGAGGATGGATGCGGCACTTCCACTACACCGCCTAGTACATCATGGCGCACGCTAAAAGAGTCCT
TCCTGCCTTGGGATCAGATTACTGTCATGCCTGCGGTGTATTTCTGTCGCGCGGTCAATGGCTGAGCAAGTTCTGAACCCGCCACCAACCAGTTCTCCAT
CCCACACGAGCTAAGCGCGACCAAAAAGCAACGAAGAAGCGATGGATCCGACAGCAGCCGCGGCACCACCGGATGCGGCCGCTGAGGTTGCGCGGTTGAA
GGGCGAGGTGCACGCGAAAGAGGAGGCTCTGAACGCTCTCAAGGCCAAGACCAAGGCGTTCGTGGACAACATGCGCGGCCAACTTGCGACCGAGACGAAG
AAAGTCACGGCTTTGGAGGAAAAGCTGAAGGAGGCAACAACCGCTGCAGTCTCGGCTGCTCCACCTGCAGACTCTGGCTCGGCAGAGCATCAGCGTCTGT
CCGAGGAAATTGAGAGGCTGAAGAAAGAGACCGCGGCGCGCGAGACCGACCTCAAGACGCGTGCCAAGTCCTTCGCAGACGCGATGAACTCGCAGCTCGA
AGTTGAGAAAGAGAAAAGCCGCAACCTTGAGACCCAGCTGCAGCAAAAGGCTGAAGCTCTTGCGGCTGCAGAAGCTGCCAGGGCCGCTGCTGACCAGGCT
AAGGAGATGGATTTCCTGTCCCAACCAGTGGCTGCAGGCTCCCACACTGACGACGAGTTTAATGCACTGCAGACTCAGTTAAACTCGGCGAACTTCGAGA
TGGCAGATTTGCGCGAACGTCTTCGCAGCATAGAAGCAGAGGCTTCGCAGTCGTCCCAGCAAGTTGCGAGCCTCCGCCAGGACATGGAAGCGCTTCGTGT
CGCGGCGGAGCAACAGCGCAGTCGCCTGCACGAGGAAGTTGACTCCTTGAAAGCTCGTGAAAGCTCGCTTGAAACTGCGCTCAGTTCTCAGCAGACCCAA
ATGAAAACCGACGAGAACAGTCTGCTGGAGGCTGACCACACCAAGATCAAGGAGCTGGAATACCAACTTGAGCAGCACAAGATCGAGAACCAACACCTCC
AGAAGCAGCTATCGGATAAAGATTTCCAGCTTGAGCAGCTGGACAACTACCGCCGCCGAGCGGATGACAGCGAATCAAAGGTGCTCCAAACTCAAGCGGA
TATTGCCTCGCTTCAGAGTCAGCTGCAAGCCAAGTGCGATGAGGTAGCGTCGTATTCGTGTAGCAAATGCTCGGAGCTGGAGGACAAGCTCGCGGAGATC
ACCCAGCTGTACGAGAAGGTCAACCTTGGCAGAAGCCGCAGCGACAGCTTGATCGCAGAGACCCAGTCGCAGCTCGGCGAGATGCAAACTATCAGGCAGC
AGTTCGTGGCCTCTCAGGAGCGTCTCGATGACATGATGAAGCAAAACTTGACACTCAACGAGAAGATCTCCGAAAAGGAGATCGAGGTGTCCACGCTGAA
GGCCGAGATGAAGAAGTGGAGCATGGAAATGGCTGAGCTTCAGGCGCAGCACAGCACGCTGAAATCGGACACCACGGAGCACCGCCAACGCTCCGAGTCG
GTCAATGCCGAGTTCCAGAAAGCCGAAGAGACTCGGAAGGAGCTGCAAACACGTTGCGCGCAACTGGATAAGAAGAATCAAGAGCTAGCGGCATCGATCG
AGACCATCAACAAGGAAAACGCTGACAAACGTCAGAAGGCAAAGGCGCTCGTGCAGTCGCTGGTCAGTGAGAAAACGAGTCTTCTGGAATCAAGAAGCGG
GCTCCAGAAAGAGGTCGACCGCCTGCGCATGGAGGTGAACCAGCGCAATGTCGAGAACGACCAGCAAGTGAAGCAGCTTCGGGATGAAAACAACGAAAAG
GTGTCTCAAACCGCTGCAACAGTTCAGAGTCTCACCGATGAAGTCGCCTCATTGAAGCACGCCCTCACTACCGTTCAGGAGTCTGAGAAGGTTCAACAGC
GCGCAAAGGATCTCGCTGCGGCGAAGCGTGAAATCGAAGACTCGAACAAGAAGCGACTGGCAGCGAAGGCCGAGACGCAGAAACTTGCGGTGGAGCTCGA
GAACACTCACAAGTGTCTCGACCACATTATGACGCACATCAACGCGAACTGCACGGAAAATGTGCAGCAGATAGCTATAGTCCAAGGACACGTCAAGGAG
GCCCTTGAGGTCTTGGAGAAGCGGGCTGCTGTCGCTGGTCACGCCAAACAGCAGCGCCCAGAGGACAACGACACGGCTGACATCGTTCGCAATGCAGAGG
CGCTTTCCGGCGTGAGAGGCGGAAACGCAGCGCAGAACCCTGGGACGAAGCGGGTCGAAGAAAACGTCACACGGGTCAGTCAACAGGTATGTCGATGCAG
TCTTGATTCTTCTGTTGAGTGTCCACGATCTGAGCGATGATGTTGTTGTCTTGCACCAGTTGAGGCTGCTAGTCGACATTACCGAGCGGCTGTGCGATAT
CGCCGTGGAGCAGAACGATGCCAATCTCAAGGACGTGATTATCAACAAGCTGACGCAGACGTTCACGCAATGCTTCTCCGAGAAGCTGATGACCGTCTAC
TCCAAGGCCGACGAAGCTGTGGGTCTATTGAATTCACACGGACCGACTTCAGAGAGTGGCAATGCAGCCGTTAGACCGACCAGTTAAACTCCACGATAGC
AATCAGCTCCAGAGCAACGCCACTAGTAGCTGCATACCTCTATGAACAAACACTAATCAACCACCTCCCACAAAGGCATCGGTTTAGCTCGCCTCATCAC
TGTCCATCTGCTCTTCGGGGGCCTCGCCGTCCACTTCTTCGATTGGTGGCGTGAGTCCGCCAGTAGATCCCGTATCGTCCTTCGAGGCGAAGAGCTGCTC
ATAAATGTCGGGGTGTGAACGGCACTTCTCTTCCAGTGCACTCATCAAAACGTTCGGCTTCTGAACAACTCCTTCAGCGTCGTGGGTACCTTCCTCCTGT
TTTGTTTCCTCATCCTGCAGCACTGTTAAGCGCCTCATAATTCCCTTGCTGTGCTCGAGTATTTCCTCATGAGCCGACAGAACGCTACGACGCTCCAGCG
CTGCAATAAGCACTTCCCCACTCGCAGCTCCATCCGCCGCGGACGAAGGACTTTCCATGGCGGTGTGATCGAGCAACCCAACTAGCAGCTCTGCCACGTC
TTCCCACACGGTAGGAAACTTGGTGCATGTCTGCAGCTTTATCAACTCTTCGCACACCACATGCGATAGTAGCTGAACCACGACCACGTGCGGTCTCAGA
GCTAGCGGGTCTTTCATAGTTGATGGTCGTCGGCGACGGCCAGTTGACCCCTTAGAATCGCTGCGCGCGTACACATCATTTGGGTGCTGAAAAGAGCCCT
CGTCGTCAATGGAAGGCAGCTGTCTCCGGTAATACAGGAACGGTGAGTTTGTTTCCTCTTCGTCGTCTCCGAAATGCAACCCCCCACCCGAATGCTTTGG
TTCAGCACCGTTTAGCAGGTCGAAGCCGACAGGTACAAGTCCGTACCGAAGCACGTCCAGCCAAGCTACAGGTTTAAACGATTGCTCCGTTCCTGTGTGC
TCACGTAGCATGTGCTTCAATCCTTCGATTGCCGCGACGACGAGATCGTTGGAAAGCTCCTGCTTAATCTGATTGAGCAGCAAGTGCCTCGATACAACAG
TCATCCCACCCAAGAAGCGCAAGCGTTCCTCCACATAGTTGGGCGCGTCAGGTCGAAGTGTGTCAAACATGAAAAGGAGCAGATCGATTGGACGCGATGG
AGCCCAGGTATCATGTGGGTCGCGGGCTTTCATGGCGAACATGATCATCTTCGTGTAGCAATCGCTGATAAGAATTTCGTTCCCGTCTCCATTCCAGATC
TTCTCGGTCACGAGGCGCTCAAGAAGCCCAAAAGCGTGCGAGGCTGCATGCGGCATTCCAACAGACCAACTGATCAAATTGCAGATCGTCAACCAGTCCA
CGCGTGTGTAGCGCAAGTTGCTTGGTTCCACCAAAGTAACGTATCGATCCAACCCGCACATGATTGGCGTCAGGAACGGTCGGATGAGCTCGTCATCACC
GCTCAACTCCATCAAAGTACTCAGGAAATTTACGAGCAGCAACCCGTTCGCATCACTGCGCGTACGCGTCACCCAAGCAAACAAGCCATTGATTGACTTT
TGCAATAGGAAGCACGCGTTCTCGTACGTCAGCCCGCTCGGGCTTTGATTAGTGAGCAAAACTGGACGTACGAACTCCAACATTTGGGTATAATGCGCTT
CCAGCACAGCAGATATTCCGTCTTCATCGTCTGGACCGCCATCGAAGAGGGAGCCGCTCAGTGAAATGACCTGGCTCAGTAAGTGCTCAAACAGCACACA
TCCCCCCTGGCTTAGGGACAGCTTCGTAGACTTCTTTCGGTCTTTTCGAGACGCCTCCTCGTCAGGGCCTTGTAGCACCTGCAAAATCTCGTCGTGCAGC
GCCTCAATGACCTCAGCTAAGGCGCGTGATGGCAAGCTTGCGACATCTTGCATCAAAAATTCAAGGCGGTAAGGCTGCAATGTGGTTCGAATCCACCGAT
CCGTTCCAAACTCTCCTCTCGAGTCATTCTCGCCATCGGATGGCTGCTTGTTTGGAGTCGTTCCCTCGATCACAAGGTCTTCCGTGTGCGAGGCTAACTC
TGCTGGGCTTAGCTGATACTGCTCAAAACCAGGGGAAAGATGCGACTTCGCTGGTGTCGATGAGTCCGGTGCCGAGCCGCCGAGATTCGAGTCGAGGGCT
GATAGTAGCCACGCAACACCACTAAAGAAGCCACCAGTATCGCCATTTCCACCATCCTGATCTTGGGCGCTAAGCGCGATCGTCCGTTCCAGTTCTTCCT
TGTTCTGGTACACCAGGTCAATAAACTCTAGACGCTCGTCGGACGTCATTAGCTCCAGGTTCATTTCATCGCTCGGATACAAAATACGCGATGGCAGAAC
ATGAAATTCACGTAAACCACCCACGACATGGAAGAAATGCTTCCACGAGCGACTGTGCAGGGACAAACTGCATGTGTTGACGAGCTTCAGCACAGCAGCT
GTCGCGACGGGAGCACTTTGGTTGTCGCAATACACCCAGATGCCGTTTTCGCGACCATTGTATCCCACGGGATAAATATCCGACGAGAGCAGCGCCGTGT
ATTTGCAAAGGCGGATAAACAGTGCGTTGCAGTGCTCCACCAGCGACAAATGAGATGCCACTGCCGTGCACAATACGAAACCGTTGCATGCAAGCTGGAG
CGCACTTTTCTGCGGTACATAGTGCATCTCATAGCTGCTGCCAACAGAGAGGTCCTCGCCTCGTGCAGCGTCCTTCGCCTGTGAATCAACGACGAACTGC
TGGAACACACTGCCAAAAGCTCGTACGAGGCTTTGCTGAAGCAACTCGAAGATATGGCGATCATACTGGTTGCCTGAAGAGCCATAAAGGGGTACCAGTC
CATCGAATCCATCCTGCTGCTCCCACGTTCCCCTCTTGGACAGACCAGCAGACCCATTAGCGGGACTGGAAGCGCTCTTGGTAAGCCGAGCTTGTTTCAT
CGTTCGCATGACATCAGGAGCTAGAGGCGACGACACATTTTGCGTGACGCCAACGCCGCGAGGAGTGCTAGATGATCGGAGGTGCAGCGACGGGTGATGT
ACGATCAAGCGCGAGTTACGAGGGTTGCTTTCTGCCTGGTTGAGTAAATCCTTCCATCGATCACTTGTCACTTCGCCGTGCTTACCGCCGTCTTCAAATG
TCTTAATCTCGTCCTTCGCAATGGTATTGTACAACTCAGTCAGGAAGTCTTCAGGCAAATCTTGGCCCTTGGAAACCTCCTGGCCATAGTTTTTGTTGTT
CTTGATGAAGTCGATCAGCTTCATTTTCTTGTCGGATCGGATATTCGGGTTGTGCAGATCCGTATTCAGCATAATCAGACTGAACGACAGCAGATACGCT
ACATCTACGGATGCCATGAGAAACCGTTCACGACACTGTTCGTACACTTGGAGTGAGAAAGTGTTCAGGATGCGGTCGATTTGCTGCGCCTCTCCAGGAA
GGCGGAAGCTCGCGAGAAACATCCGCAGCGCGGTAACAATACTCTCACCCTCAAAGTTAAATGATCTAACGAAGTTGGTCAGGACGTCGCGGTGGAAATC
CATCGTGTCGGCCTCATGGATCTCGGTTTTCTCAAACCCTTTGACCTCCTTGCCCATCGCACCCAAGTACATGCCCACGGCATTCTTGTTGAGGCCCTGC
GGAAGGGATCGCAGGAACGTTGCAAGCGACATACTGTCGAGTGGTGTAGGCAGGAACGTGTTTTGCTGCAAATATTTGATTCCAGCCAATGGTTTACGGT
TGAACTCTTGGATGCCATGCTGGAAAAACTTCTTGCGCTGTCGTTTCTTAAACAATACGTCAGCAGAGGCAAAGCTGTCGCCATCAGCAGCAGGTACTAG
CTGCTCGTCCTGATCCACAAGCAGCGCATCTTCGTTATTCTCCTCGTCACTTGGACCACTGCTGTCACCACTCAGTGGTAGGGGCTCTGGGTGCGTACGG
AGATGAACGACGTACAGTGCATTGAACATTCCGCGAAGAGCGATTTCTCCAATAGCCTGGGCCCACAGGAAATGTGTTTCTTCGTGTGATTCAAAGCATG
CAACATGAGACTGTTGTGCTACCTGAGAAAGGAGCTCGAATAAATTCTGCGTCAAGTCGCAGCGGTTGCCGTCGCAGTCGTAGTTTACGTACAAGTCGGG
CAGCAGCGTAGCCTCCGCCAGCAAATCCACCAAACAATCCATAATTTCAAACGAGATATTGTACAATCGGCTTTTGGACAGCATATCTCCGGAGAACTCA
TCGAGAGCTGCTTCAACAACTGTAACAGTCTTGTCGTCTGTTTGGCCGTTAGCACCTGCAGCCGGCGGGGTCACGTTATCTCCACGCGGGAAATCTGGGT
TGTTCACATCCATGTTCGCAAGACTCCAGTGAAGCGTCTGGCAGAACACGCCATTGAAGATTGCCTCTACCTGCATCTTCAGGTCTGAGCGGAGCTTCGA
CCAGAGCAACCGGATAAGCTCGAGACACACCACTGTAACCTTGAGCTCCGCGCAGGCACTGCTCATACCATTTCACGGATTGGGAAAGTTAGATCAACAA
AAAATGGCGGAGCATAAAGCAACATTGTTCCTACCCTAGACGGCAGTAGCGCAAAATGGCGCTACACAGATCGTCCTTGATGAAAAGCATCAGCGACGGA
ACTTTCGTAATCAGCTCGGCATCACACGCGATCAGCGCGCGTTGGAGAAGACTGAAGGACAACAAACCTTCACGCCGGCTTGTCGTATTTCCAGTAGTCC
CCACGGGTGCGTCTGGGGCAGGAGGGGGCAGGAAGTTTCTCTGGTGCAGCTTCTGGCAGAGAAAGCCCACGATCTTCACCGCACACGGCAGCCCGAATCC
TGGTCTAAGAGGCTTAGCAGCGGGTGCCAAGTCTGAATAGATAGCAGCGTTAGAAAAGATGAAGGCCACTGTATCATGCAGAAAGTTAGTAGCTGTAGAT
CGCAACGGCAGCGTAATATGGGGCTGTAAACACACAACAGTGAGTCGTCAACACCAACCCGATCCAGATTGACCAGCAGCAGCACGTACATCATGTCGAT
TGCCGCGACTGAGCACGTAGAGCGACTCCACCAGCTGCCACATGGAGTGGTCCGAGAGTCTGGCACCGCAGGGCGAGCGCACCACAGCGTGCAGCACGTG
CACGACCAGCACCAGCACGTTCTGGTCGCTCTCGATGGCCGTCTCCTGGAACCTGCAGTGGCTGACGGCGTCGACGACGTCCGACACGGCGTCCGCCGCC
GCGTTCTGGTCCTTGACGTCGGCCCACGGCCACGAGCGCAGCAGGTTCATTACGGCTTGCAAAGCGGCACCTGTAACGGTGCTGCTGGCATGTTCGTGGC
GGATCACGTCCAGGAACGGCTTGACGACGTTCACGGGCGACAATTCAGCCATATCTGCGTGAAAAGGGGCGGAAAAAGCGTTAAAACAACGCATTTCGCA
GCGTATAGAGGCGTAAAAGAAATTGCACGCACTCTCGCATCGCAGCAGACGTCCGCGTAGCACCGAGAAGCTCTGGAAAACGGCCAGGGGGCCCTCCTGT
TGCCATAATAATGCAAATATTAGCGCCTTTTCACCTTTTTGAATAGAGGTTTTCGAGGAGAAGACGCTTCATATCGCACCTGTTTTGAGCGCTGGTCTAA
CGTCCCAGACAGCAGAAAGCCATGTCGCCGCCGCGCGAGACTCAGCACGCTCTGAATGTCGCTCAGCAGCTCGGAGCGCGCCGCCGCCATCTCGGTGGGC
AAGGGGACTCGCTATTGGACAAATGACGGCTTCGACAGCACAACATCCTTGGTGTGGTGCACAGTACAACAATGTACACCACACTGTACAGATTGATGGT
CACATTAATGAGATGGCTACACGTTTTGTGCCGACCATCAAATGCGTGTCACTTTCCCTTCGAGCAACTCCAGCTCTGATCGACTATTGCCATGCAGGTG
GTGGCGCTTGTGAGCGGCGGCAAGGACAGCTGCTATGCCATGATGGAGTGTGTGCGCTTCGGCCACGAGATCGTGTGTCTGGCGCATCTCCACCCGCCGG
CGGAGCTGTCAGCGGACGACGCCGAGATCGACTCGTTCATGTTCCAGAGCGTGGGCCACCAGAGCGTGCGCCTCGTGGCCGAGAGCATGGAGCTGCCGCT
GGTCTCGGAGACCATCACGGGCACCGCCGTGAGGACGGATATCGACTACTATGAATCGGCGGCGGGTGACGAGGTCGAGGACCTCTTCCGCCTGCTGCAG
AAGGTCCAGCAGCAGTTCCCGGACGTGCAGGGCGTGTGCACGGGCGCCATTTTCTCCAGTTACCAGCGGAACAGAGTGGAAAATGTGTGCAGCAGACTGG
GACTCACGTCGCTCGGGTTCTTGTGGCGGAGGGACCAGACGGAGCTGCTGCAGGAGATGATCGACTCGGAGATGGACGCGATCCTCGTCAAAGTGGCGTC
CATTGGGCTGCTGCCGCACAGGCACTTGGGCAAGACCATTGCAGAGCTTCAGCCGCAGTTTATGACGCTGGTACGCGTGGAGCGGAGCGGAGGGATTTGA
ATTGTGTACTGATTCCTGAGCCTTTTGGGGTGTGGTGTTTTTGTGTTGGTGTAGAAGGATAAGTACCAGATGAACGTCTGCGGCGAAGGCGGCGAGTACG
AAACGTTCACGCTCGACTGCCCGCTGTTCAAGAAGCGAATTGTGATGTGAGTTTACTTGGCTCGCTTTTTCGCTGTTGGTAAAGTACCCTTACGATCGTA
CGACATGTTGTGCATTTGCAGTGACGAGAGCCATACCGTGCTGCACTCGGACGACTACATCGCGCCGGTCGCCTTCCTGTCGCTTGACAAGTGCCACCTG
GAGGACAAGGAGCCGTCAGACCCCTCGCAACTCGCGTCGAGGATCCCAGAGGCGATGTCTACCCCGTCCGCACGTAGCGCAGCGCCCACGGATGCGAAGC
CTGCGACCGTGTTGGCACTCACGCAGCCGACTGGGCGAGAATTTATCCCCGCATCGGGCCAATTCCGCGACCAATTGTATCTTTCGGGCATCATGAGCAG
CAAGGCTGGCGATGAATCGATCTCACTCGAGGAGGAAATGGCAGACATTGTTGCGCAGGTGGAGGCTATCCTCGGAAGCCACAACATGGTGCTGGCTGAT
GTGTGCTTTGTGCACTTATATGTTCAGGACATGGCTGCCTTCGGTCAACTCAACGCTGAGTACATCCGGTACCTCGGCCAAAGTCTGCCGCCATCTCGTA
GTTGCGTCGAAGTGAAGGCACTGGCAGACGTCCCTGCCCGCTTGCTGATGGACTGCTTCGCCTTGCGGGACAGCGGTGAGCAGAAGTTACTCCCCCTTCG
TGTGCGCCGCGATGTACTGCATGTGAAGAGTATCTCCGCCTGGGCGCCATGCTGCATTGGACCGTACAGCCAAGCTAATGTGCTGCACAGAGCGCTAATC
CTGTTGGCCGGACAGATCGCGCTGTACCCTCAGACTATGGATCTCGTGCCAGGCGACCTTGGTGTTCAAACGACGCAATGCTTTCGCAATGCCTGCCGCG
TGTTGGAAGCGCTTCAGTCGAATCTCCGTCACGTGTGCTCTGGTGTCATCTACACCACCGGAGACCCTGACGACCGTGAGACTCGAGAGCGTTTGCTAGT
CGACAGCCGCCGCAGCCTCATGGCTAACGCCGGGTTAGTGGATGAGTTTGAGCTTGTTGAAGACAGCGATGAGAGCGATGAAGATGTGGACAAGAATGAG
GCGCAGGTGGAATTCGTGAAGCAAGCGCCGTTGCTGGTGGTGCAATTGTCACGTCTTCCACGAGACGCTTTAGTCGAAGTGGAGCTCCAGGCGCTCACTC
ACGTCGCACTGAAATACCTGGTACCACGCAGCTGGACGCGCACAAGGAGCGCAAACAACTTGTCCTTCGAGTGGCAAAGCGCTATGGTCCCTCGCGCGCT
CTGTCAGATTATTTGTACTGCGTCAGTAAATGATGGCGAAGAGTTTACGAGCACGCGGGGACTCGGCAAGGCTGTTGCAGAAGGCGTCTGGACGTGCGTG
CTAGATAGTCTGGTGGAGGCGCTTATCCCGTGGGACCGAGTGATCCACGTCCGCACATTCTACGTGGCGACTGCATTTTCAAGCGAGTTGGAACTGGCCA
AGGCGTATCACGAAACGGTGACAGCACGAGGAAAGGTGAGCAGCATGCCCGGCATGACGTTCGTGCCTGTGGACGCCATCCAGGGCGATGCTGTAATGGC
GATGCAGGTGACAGCACAGGACCTGGACAAGCTCGAGACCGAGCTCTGGCTGCGCAAGCAGATTTAGACAATGCTTCGCGAGCTCGTAGGCAACACGGGG
TAATGAAGGTATAACTGCAATTTGTCATTGTTTAGATGATTGGTATCTCGGAAGGCATCAATTGAAGGTTGCTTGCTCTTTCTGTAGTCTAATGCCGTCG
TCTACGACGCTGACCGCCGCCGGGGCCTCGGTTACCGCCGGAGCTCTCTTCCCGACTCTTGCGTTTACGAGAGTCGCGGTCTCGGGATCGCGAGCGTCCG
CTTCGATCTCCTCGGCCTCGTCCAGCCTGCTCTTTCTCCTGGTCTGCTACTGCAGCTCCGCCGCGACCTTCGCGCTCCCGAGGTCGTGCCTGCTCACGAT
CCCGGCCACGATCCCGGTCGCGTCCGCTATCACGATCTGGTTCACGACCACGGCCACCATCTCGTGGGCGACCACTACCAGGACGATCCCGTTCACGCTC
ACGGCCGCTGTCGCGACCCCGATCACGACCAGCGTCACGCTCGCGCTCGCCACCGGGTCGACTCCTTTCACGATCGCGGTCACGGTCCCGACCACGTTCC
CGGTCTTTGTCTTTTTCTCGGTCGCGACCTCGATCCTTTTCGCTGGAATCCTTGCTCTCGGCAGCGTCCCGACGCCCACTGCCTCGCGAGTCGTCGCGGC
GTGGGCGAGAACGGGATCTTGAGCGATCGCGACTGGCCTCTCTCGATCTACCACCGCCGTACCGCCTGTCATCGCGATCATCCTTTCCACCGCGACCACG
TTCGTCAAAGCCGCCGCGGCCTCCACCTCGGCCCCGGCCACCACCTGGACCACCCATCCAAGGAGGCCCTCGTCCTGGTCCAGACCCCCAGGGTGCGCCG
CCCATCGGGGGGCCATTCCAGTTCTGCTGACCCATGAAGCCTGGGGGCGGGCCCATCCCAGGGTGCCAGCCACGCGGGGGTGGCCCCATAAATCCACCTG
GACCTCCGCGAGGCGGAGCGCCCACGCCAGCTCCATTCTGTTCGTCCCCTTCAGGCTTTATCTGTCCTGGGAACCCGCGGCCCTGCATCTTGGCGTCTCG
CTCGCGCATCGCCTGCTGATTAGCAGCATTCACAGCTTGTCTCGACGCTTGCTCCCTCGACTTCTCCATCGCCAGATCCCGTCTCAACCTGAGCTGTCTC
GCTGCATATTCTCTCCACGTATGTTCGTCAAATCCGTAATTAAAGTAGTCCGAGATGTCCACGCCAGGCTTGCGCCACGGCCTGTCCTCCAGCAGGTCAA
TGTCCACATCGAACGCCGTCCGTCGTCCGCCGAACATGGCCATGTCGTCCACCCCGTCCCCCGTTGAGTCACCGTGCTCTCCTGGCTGGTGGGAGCCTGG
CGCAGCTCCAGCTCCTGTTGCTCCTGTTGCGCCATGCTGCGGACCGCCGAAGCTGCCGCGCACGAAGCGATTGCCGCCGCCCGTGAAACGCAGCGTGGGT
TTGCCGCCTGCGTGGGCTGTGCTCAGCACAATGGCTACGTCCTCGTCGTCCTCGTCGTCCTCCGAGTCGGCCGCCGGGTCAGCGCTGGTCTTGACACCAT
TGCCTGCAGCAGCGGAGGCCGCCGCCGCCTCAGCCTGCGACGTGGCTGACGCGTTGAGCTGGATGGAGACACCACCGTAGAGCTCCTCGTCCTCGTCCTC
CTCGACCTTCTCGGCTTCTTTCTTGACGGTTTCGACCTCCCACGTCGCTCGGGACTCCTCCGTCTTGGCCTCCTCCTTCACGCCGCCGCCCACGCGCTGC
GTAGTCACCAACACATCCTCGCCAAAGTCCTCGTCCTCCATGGTCCCGGATATGAACCACCGCGTACACCAAGGGGAAGTTGTGTATCGTACACAAAAAG
GTGCAAATACGGGTTTGAGACCCGACCCACCCGTTTCCGCACTTTACAGGAGATGTAGAGTGCGTAGTGAAAGCGCGGTGATTGGCTCGCGGGGTGTTAT
ACTTGGTGTTTGTATGCTGGCGCCTCCGCGGCCAATAGTTTCGCGGCCCACAGCGCCCGAGCCTCGCCGACTCACGCAGTTCTTCTTGTCTCGTTCGACT
TTTGCAGGTAAGCGGGGCGTCATGCTCTCTGGGCGATGGGGAGCAATGCAGCCATGAACAGTGGGGGACGCACGTGGGGACAGATGCATCAATCAATCGG
GGACGGAAGCGCCTGCAATGACGAGCTTCTAAGCGTACAAAGTGACGGAGATACAGGCGATCAAGCAAAGCGAAGGAAAAGTCTAGAACGCTCCGTCCCG
GAAAGATTCCTCTGTTTCCAGTACCGTTTCCACTGTGATCGCATATGCAGCGCTCCCCTCTACACGTCGCAAGCTTCGGCTCGCTCTCACGATGCCTGAA
AGCTCAGTTGCTAATGGATGTATCGTGTCTTGCTGCAGTTTAGTCAAAGATGCCGCACTCCTTCGGTTACCGCGCTCGCACGCGCGACATGTTCGCGCGC
CCGTTCCGTCAGAGCGGCATGATCAAGATGTCGACGTACCTGCGCACGTTCAAGGTGGGCGACTACGTGGACATCAAGGCCAACGGTGCCGTGCAGAAGG
GCATGCCGCACAAGTTCTACCACGGCCGTACCGGCCGCGTGTTCAACGTGACCAAGCGTGCCGTCGGCGTGCGTGTGAACAAGATCGTGGGCAACCGCAT
CATCCACAAGCACATCAACGTGCGCATTGAGCACGTGCACCAGTCCAAGTGCCGTCTGGGCTTCCTCACGCGCGTCAAGGAGAACGAGCTGAAGAAGAAA
GAGGCTCGCGCCACCGGCGTCCGCGCTCAGATCAAGCGTACCCCCGGTCAGCCCAAGGCCGCCTACACCCTGAAGACCAAGGGCACCAAGCCCATCACCA
TGGCGGCGCAGCCGTTCGTGGACCTCATGTAAGTGGCTTTGGTGGTCTCCACTGTTGCAATTTACTGTTGGGAGCTTGCGCTCGGCTTGAGGTGAGACGG
ACAGTCGCTCCCGGGCACGTCGTAACCCCAACGAGCTGGGCAAAATGAAAGAACGAGTCGAATCCACGGCGTCATGCTTCCCTT