Description :
From Genome Similarity Track
Location :
scaffold_18:293804- 295224
Transcript NameFunction/comments
Plaha_PHALS_15096hypothetical protein
Plaha_PHALS_05501Uncharacterized conserved protein%2C contains HELP and WD40 domains

Sequence
1420 bases(100 bases per row)
AAAGCGGCATTCTCGCGGCTTCAAGGCGTGCAACTATACTTTTAAGAAATTACTTGAGTTTCGTTTTCTAAACTATTCATTTGCTTGCAGCAATAGTGGC
GGCTTGAAAAAGCGAACATTGCGAAAGGATAAAGCGAAGGATGGCTACGTAGCAATAAAATAGTATTACATGGGTGAAGACTGCACATTTTCGCCTTCAG
CGAAAGGCTACCATCCCTTTTCTTTCCTGCACCACGCCCTTGGTTACGAAGGTAAAGGGGCTGAGAAAAAAAGCATCAGCGTGACGTTTGACTCGAGTGA
TTTAGCGTCGACGTTTACTTTTTTTACGATAAGTGCACCACACCATATGCAATCTTAAAAAGACGTGTTGGATAGATACGCTTTAAGTTTTCAATTGAGT
TTTGATGGGAGCTGCCAATGGGACACAATTCCGTCTTGTAAATGCCACAGTTGAGCTGCAACGTGAAACGAGAGACTTTGCGCGATGTAATACGATGGTA
TCGTGCTCATTTTGTAGCTTAATGCTCAATTGTCGTGTTGGTGGCGACGTGAATAGGGACGCTGGCGGATGTCGAGCAGCTGCATCGGCGCTTCAACAAA
ACATTCGGCTTTTCAATAACCGCAAgtcaatttgaaaatttgttgTTGTGTCAAATGCCTGAAAGTGTCGGAGTTGAAGAAATTTTCGAAGCTCTGGACG
TCAATCACGACGGCCGGGTGGACGGGTTGGAGTTGTTGGCAGCCCTTGCGTGTGTTTGCCGGGCGGAGTTTGAAGACAAAGCAAGATGTAAGTCAGAATC
GGCTGTTTGTGACTAAGGTATAACAACTCTTGTTGCAGTCACCTTTGATCTCTTCGATTTCAACCACAATGGGTCGTTATCATTGGTGGAGTTGGTACGT
AGATTTCTGGCTTCTCTGCATTCTGGGCTGATCAGTGACTACTTAGGCCTTTTTGATGAAATCTGTCTCTATTGGCATGGCACTTTTGACTGGGGTGACC
ACCAATTCTGAGGACGTCATGAAGCTTTGTCTTGAACTtgcaaaaaatgcattttccCAGGTAGATGACGAAGCATCCATGCTCGGTTTTGACGATTTTA
TCGCCTGGGCTCGTCAAAATCGAGAGTTCATGCTTCAGGTTGAACACTTTCGAATTATTGCTGCCAAATCCATGGAGTTTGAAGATGCACTGTCATTACC
CGAAGGCAGTGATTATGATTCAGATCTCGAAGTGGAAGAGTTTGAGATCTCAGCTCAGCGTCAAAATGCTGCTGAGCCAAAACCGGTCAAATGTTCTGCA
CCTTGGACGGAAGAGCCTTTGTCGCCACCTTCACCAACAGATACTGCATACGTAAGTGAGACGATTGGCATGCCACCATCTGCAAATTTACGTCTAGAGT
GGGTCTATGGAACCGGCGGA