Description :
From Genome Similarity Track
Location :
Scaffold_24:2938- 7556
Transcript NameFunction/comments
Phyta_totarag1313hypothetical protein
Phyta_totarag1314hypothetical protein

Sequence
4618 bases(100 bases per row)
TAGCGACCCGAAACTTCGCTACATACAAAGCACGTCGAGAATGCTCTCACATCCAGTATTTTGACGTACCTGCACTTGCTGATCATGGCCAAGAGAGTCG
TGCACCATGAAGGAGAATAGCTTGTAGCGAGACGAGTTTGTATCGTGCGTGGCGTCGACCAGGAGCGTTTCCGGGAAGACAGAAAAGAGAGATCGCATAT
GTGATGTCTGTACGGTAATACATCTAGCCACAAGCTACAACACAACCACAGAACTTGCCAATTCTACAGCAAATGCACATGACCTCTCGATAGTTCTTAC
CTGTCCTCCTTGTCGATTAATATCCACGTGGGCTACAGCAAATGGATCCTTCTCGCAGAAACGATCGAGTGTTTCTGATACCCTGTCTGATAGTGTCGCG
CCTGCGGCTTCAGATTGGTGAGCAGATTGTGCACGTCGATCATGTCCGGCTCGGACTCAGTGTTGTCCCAGATGTACCGCAGAATCTTTTTCCGCGAGAG
GCCAACCTTGTGAAGCATATTGACAGTCGATAGTTCCGCCTCCGGTAAACGCAACCGATTCCTCGGAAGGCGTTTGAACGCTTCCTTACCCACACGATGG
TTGTGCTCGGTGTCATGCACGGAGGCCCGGAGGAAGTACGAGTCGTGCTcccgctgcagcaacacgttTAGCTATTAGCCCACAACAGATGGATGTCGTT
AGTTAAGCCGTAGAGGTCAGCACAGTAGGCAGAAATCTGGGACACACCTTAACTTTGCAGCCAATGGAGTGAATGTTTTAGCGCGATCGTTTTCCAGACA
CACGGCTGCGATGCTTTCCGGCGTGGGTACACTCGTATGCAACGATGTAATACGGGAAGAATTCGTCAAGAAAGAGCTCGCTCTCCGGAGGCAGCTCGCC
ACGTTCAGCGTACGGTGCGGTTACGCGCTTGTTTCGCGCAACACGACTGGTCGAGGACCGTTTCACGTACGTCTGGAATACAAACATAACGTTAGCTTAC
TGTTGTCACCTAGCAAGTCACGTAGCGACTTACCTGAAATGTCTCTCTGCAGTAGACTTTAAGCGCATTCTCGAAGTCGGCCCAGGTGTCGTAGACCTTC
CCTCGGAGATCTAGCTTTGGTACATGCCGCCTTGCCGTTTCACTGATATCAGCGTCCGACTCCTGTCCGGACTCCTCCTCATTTGAGTAGGCAGACTTCT
CCGACTCTTGTGGAGCCCACCACTTTCGGGCTGTCATCGTAATGCTGCTGGTTACATTGCGTGGGCGCGCGTCGAGCGTCTGGCAAGAACGTGTGCTCGA
CGGGGGGGGGTTCTGAAATGAATCACAGCCACTGGCTCCCAGCTCATTAGAACGTTGCTTTAGGCGTACTTTTGACGGCGTACTATTGACTTCCGTACTT
CAAGCTAAATTGTCCTAGCCCTTGCAATAAGATTGTTAAAATGCTGGCGCTCTCCCTTTTGGATTCAGTCACTCTCCTCCGCTAAATCGTGCTGATATCG
CTAGATGGCATTCGGAGGATAGTCTCACACATCAATGAGTCGATTCAGAGCTGTAAAACTCCTAGAATCAAATAtttgctgcaggtgttggCCGCCACGA
ACGAATCCAAGTGCCAACCTATTTTCACAATCATTGATGGGGCTGATGTCAACAGGCCCATGGCATTCTTGTGTCGCTCTGGTATTGCTACCAAACCCTG
GTGGCGTCGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCAG
GCCTTGGGCTACGCGTTACACTGCCTAAGACTCCGTGAAGGAGTGTGTGGGCACCCGCGACGGTCGACTGGCTGGCTGGTTGACCGAGCTTGCTGCCGGC
TCGAATTCAATTTCAAGATATGGTGGGCGGGCATAAGCAGCTCTCCATCGGACACAACACCCCGCGGACGGGTCGTGCAAGCTGTGGTAGAGTGTGTAGG
CAGTGGTAAGGAACGAAAGCAACGTGAAGTGAGTTGGAGTCATTGTGACTGGTTGGAGTCGAATTTCGAAACGCGGATTGCGCGGACGGGAGGCGGTATC
GATGGGTGACGAGTGCGGTGCGTCCAGGAGCGCGTGGCGATGCGTGCGTTGTCCGTAATgttgattttgttttgtgtgtgtgggtATGTGTAATATCCGG
GGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAGGGATCGAtaccctgcttctccaggCGTGTGTAGTATAGTGGTCAGTACCTC
ACCTTGTGGCGGTGAAATCCCTGGTTCGAatccgggcacgcgcacTCTTATGCTCATTATGCTGCTCTCTCTCTACCTTTGCTTTATGCCTGCGTGGCCG
TCCCGCGTGGccgccacgctgctggcacACGGTCGCTGCGACTACTGGCCGTCGGCCACGCCGCTGTTTGACTcctgcaccgccgccacgaACGAATCCA
AGTGCCAACCTATTTTCACAATCATTGATGGGGCTGATGTCAACAGGCCCATGGCATTCTTGTGTCGCTCTGGTATTGCTACCAAACCCTGGTGGCGTCG
GNGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCATTGTCGGACTCAGGCCTTGGGCTACGCGTTACACTGCCTAAGACTCCGTGAAGGA
GTGTGTGGGCACCCGCGACGGTCGACTGACTGGCTGGTTGACCGAGCTTGCTGCCGGCTCGAATTCAATTTCAAGATATGGTGGGCGGGCATAAGCAGCT
CTCCATCGGACACAACACCCCGCGGACGGGTCGTGCAAGCTGTGGTAGAGTGTGTAGGCAGTGGTAAGGAACGAAAGCAACGTGAAGTGAGTTGGAGTCA
TTGTGACTGGTTGGAGTCGAATTTCGAAACGCGGATTGCACCGCCTCGCGTGTGGCGATGCGTGTGGACGGAACGTTAAACTAGATGGAACCTGGCGGAC
ATCATGAAGGTGGTGTGACATTTTACTATTGGTTCTGTGCTATTGCAAGTACAAATCGTTCCTGGTATTGGGGTCAGCTTATCCAAGCCTTTTGCACTAG
CACCAGCGGGGGTGTAAGCGAGCCAAGGACGTCGCCACAAGGACTTGCAGTTGTATCTACTTATCGTATGAGTCGCGGTATTCGAAGTGCCCACGAAGTG
GCAGGATGGCATTAGCAATGGATTGGTTGCCAGccagctggaggagcagtTTGGAACCAAATGGTGCGGAAGAGATGAGAGGAGCTTTTTCAATTGCCGC
CGAAAAATCATTGACCTTGTTGCGAGATGGATTGCTGGCCTATATTGAAGTCTAGTACTTCTGCTACAAAGGGAGGTGAGACGCATGCGGATTGACAGTG
TCCAATGCCTGACACCAGTGCTAGTGCCCAAAATACTGGCAGTGACCAGAGTGATCCTACGATTACATATCATATTGACGATTCTGCGCATGTCGGCGCG
GCCACGCATCTTTCGGCTTTCCAGTCCGCCGCAAACCTGTGTGTATGGTGCACTGGCAAGTACCAAGGGCTGCATGCTGAAGGGCATTGTTGATTAAGAG
CAGCCGGGATGATGCTGCGCACTACGAACGCAATGCAAGCGATTGTCTTAGCTTTATTATAGGTTTATGGTATGTTGTGTTGAATATACGTTTACGGAAC
GGCGGAGTTTGGCGCAAGGCATGTCCTATCTCTCTTTGCCTTTTGCCTCTCAGCAAGCACTACAAGAAAGAACACAACCTGCACTAGACGCCGCGGTCCT
GTCGCGGCACTTGTCCTGCACTCACGTGTTTACGACCTTCTTCGATTTCTCTACGACTACTGCCCTTGCGCCCCAATGGCATCTACTAACAGAAGCGATG
GACACCCTGGTGACGCGCATTGCGTCATCACTGGTTACGAGCCCAATCAGGGCTCAGTATTCGACTGACGTGGCGTCTGGTGCGAACGACGATTTGTGGG
AGGATGTTTCGACGATTCAAGATCAAGCTTCGCAGCCATCAACTGAAAACTCGATGACTACAGGTGACCCGACTCTGTCGCATGATGAGGTTGAGCGGCT
CATCCATTCATTAGCTGGAGTCCCGGGCGGGTGACCGCTCAGCCACGTGTTGCTCGAAGTTATGCAACGACGCTCGCATTAAGCGAAGACGGAAAGTTCT
CTACCAGTTCGAAATacgccaccgccaccaccaccgccaagCGAACCAATCAGCGACGGCAGTTCGAGTGGGGGCTCAAGCAGACACAGCGACGATCCAG
ACGGCGAGGGTACGGAGCCCACGCACCTGGACAACAACGTCCTAGGCTGCCGCTATGACTACTGAAAGTTGGCGGAGTACAACAAGGCTCTGAGGAACTC
TTGCCCATCCAGCTGCCTAGGCTGCACACCAAGAAGGTCTATAAGGCGTGGAAgaggaaggtgctgctgcactgcgaGCTGCGCACGGCGACATCACCTA
CGGCGAAGAGCGCTACGACGGGCACTTCAGCCCGAGTACACCGAGCAGTACGCTGCGAGGAAGAATAAGGCCTTCTCAGCGCTAGCGCTGGTTTTGGCGA
TGGACTTGCGGTCCACAT