Description :
From Genome Similarity Track
Location :
Scaffold_1:2937886- 2945937
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00785hypothetical protein

Sequence
8051 bases(100 bases per row)
CCACCGTCTTGTTTCTAACCATTTCCTGCAAGGCCCCATAGATCAGGTGTCCAAGGCGAGCATGCCATAGAATCAGAGCTCTTTCATTCTCACGCGTCAT
GGCTTTGACTTGCTGCACAGGGACTACGTTAGACCGTAAGCGGTAACGGCCATTCGTCTTCACTAACTTCAGTAGTATTTCACCCTTGCGTAGCCATGCA
CACTTCTGTTTGCTCAACTTGGTGAATTCCCATCCATCACTCTCCAGCTTATCCAAGCTTAGCAGATTATTTATTCCGCTAGGAGTATATAATACTTCAG
AGAGACAGAGCGACAAAATTGCAGGAGACTGATTTTCATTCTTCACTTGAACTCTCAGTTCTCCAACCTGCCCTCTGTTCCTGGATGGGACTCCTTCCCA
GTCAAACACTAACGGACCATCATCTTGGCGCAAATCTGTAAACAACTCCTTAGTCGTGCACACGTGACAGTCGCTCGCAGAATCGAGTACCCACTCAACA
CCAATATCAATTGCGTTTTGCGTAGGTTCCACATTACACAATTGACGCGACATCATATCCACGTGTCTCTGGCTGCCACCACTACCTCCAGATTTCTTTT
TATTTTCCCAACGTTTACGCTCTGGAAGTTGCGATTTCGACTCATCGTCGTCGCGTTTTGAACGCGGACAATTCCTCTGAATATGACCGGTTTCGTGGCA
ATTCCAGCATTCACGGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATTCAATGCCACTGGAATACAACGTTTTGTGAAGACCCGATCGCAGCTCTTAGAATTGGTATGTACTG
CTGCACTAGGCAGACAGAGGAGGTAGGAGAAAACTAGTAAAGTCACTTTGGTTGCAAGTCAAATGCATTGTCAATTGGCTACCGAATAACCTATGTCAAA
GCATAATATGTGTTGCCACATAGACTGCAAATTAGCCAATTAGAGCACAGAACGGCCGTCAGGCCGTGCACCCTATGTCGTTGCACATGTATGTACCTAT
TCTAACGAGATACGTGTGCTAATGGGAGCGTTGGAAATAGTGGCAGCAAAGTCCAACCCGCAGCAAACGATGATCTCCATTGAAAGCATGGAGGTGGCTA
TACATCCACAAAAGAAAACGGAGCGATCACAGAGGACGAGTTCACCATGCCGAAACCTTCTCAGGTCTTTCTTCTTGGTACAATGGAACAAGCCAAAACT
AGGAGTGCTTAAACGGTGTAAAAGCCTAGCGAACCTAAGGACAAACCAACTTTACCACCCCAACAAAGCAGAGGAGAGCTACAGAACCACTTACCCATGG
AGATTGCTGCTTTATGAGGCAGCAGAAGACAAAGTACTGGACAGCGCGGCGAACCAACCGCAGGAGATTCTTCTGGCATCGATCAAAACTCAGTTACGTA
ACTACCAGGCTTCTATAGGTACATAAAAACAACACCCAAATAGAAGGCCAACTTAACACACACCTATTCTAACGAGATAGCATACATTTTTGAACACATA
CCAGTACGCTAGACGGTGTCGATGACAACGACAAGGGCAATATCGCCGGTGAAGCCCTCAGGGGCGGTGAATAGGATTTGAGAGTTTAGGCTATGTATAT
AGGCGTAACCTTTAGCGTTAGAGCCACACCAGTTCACTTATGCTGGGACAGGAAATTGGTGGTCTATGCACCCATTTTTGCTGGCTCTCTTGACGTAGAC
TATTCGATATCTATACACATCTAGCACCAATGTGTTTTTTTAGCCGTTTGTGTGATCACTGTCTGTCATGTTGCCCACACTGGCCGGCGTCGACCTCGCT
GTCGACTCTCTAAATGGAGGGCGCAACGTGTAGCTTGAGAAATCAAGAATAGCGTCGATATTACCGACGTTCACCTCCATCGCGGATAGTATACCCTGAA
TCTAGATACGCCCAAGCCCGTACTGAGTACGGTACTCTGCGTCTGCAAGCAGCGGGCCATCTTCCATCGCGTCGTGCATCGCTATTTGCAGCGTTTCGAT
CTGCTGAAGCTGGAGAAATGTTGTATGGTCTGATACAACTAGCGGTACCCTGTTCGGAAGCCTTGCTTGTGCAGTCGTCCTGTAGTCCTGTGATGCGGGA
CCCACCGGTACTCCCTGTTCTCGAAGAAGACTGGCAACACGAGGCATTTGTTCTTGAATGCAAGCTCCTCTTTGTAGTGACGTCGTAGCCTCGACCACGT
TGGGTACGTATACACAATGTCCATCTCTGCGCAGCTTTCCTTAAGTGATGCTCTATTGAGCTGAGCTGCATACATCCTGTCGCTACAAAGCACCTGAAAG
CCGTTTTGGTGCGCGGATTTGGTGGGCTTAAGTAGATGGAGAACTCGGAACACCACTGACCCGGCAGATTGCTCACAAAATGCTCTCCATTCTTTGGCAC
GAAGGACACCGTATCCATCTGCTATTTTGAAAATTGGAAAATAAATGCTGGCGAAGGAACAACTTTGCTACGGCATGAGCCGTGAGGATCTCCATTCCTA
AAGAACAATCGTCAGGTTAGACCCTCAGGAAGACAAATAATAAAGTAACAACAACTCCAGCAATGCTTACTACAGGTTCGCGTCCACCAGGCTTGAGATC
AGAATTACACCAGTTCTGGAGCTCTGCTATCATCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGGTGGTATGAAGG
CACGGCGGACGGTGACACTCCAGGCTAGTAGCTCGGATTCGGTGACGGAGCGTGCAGCCATTGCCTTTCGCATCTTTGTGACGTACGGGCTGTGGTCAAA
GAGGCGCAGCATACCAGGGTAGTGCAAGATCAGTGTGGCGGTCAGGAACTTGGCTACGTCTTCGTCAAGGTTGAGGACATAGTCAGCAAATCCCAGAGTG
TTCGAGAACACCAGAGCCTGGAGTTTGAGTGCACCGGTGTGTAAAGTGCTGCGATTGAAGGCAAGCGAGCGCCTTCCTTAGGCTTCCACCCGCTCAAGAC
TCGAGATACCTGCTGATCAGCTTGTGTCGTCACAAGCATATAGCCAAACGCTTTGTTTACACAGTCGAGCTGCCACGTTGGATAATTCAGTTTTCGGCAA
TGGTCTCGTCATTTGCATACATAGCCCCACCACGGCGAAGCGAGTGAGAGGTGAGGCCAGGGGTGAGCCGGATATTACGAAGCTTGGGATTATCTCTGGC
CCTAACGATCAGCCTCTTAACGTAGGTTTGAGCTCCAGGGAGTAACGCGGCTGCTGAGCTTGAAGATTCTGGTATGGAAGTGTGGTCGTCCTCTGTCTCC
AGAAGCTCAACGAGAGACAATTTCTCCAGATCTTGAATGCTCACGAAGCTTCGCTTCTTTTTAAGAAACTGAGGAAACATTTGTTTGCATGGAGAGTTCT
GCATCACCAGCGGTACAGCTATATCATTGAGAGGGCATGTTAGAAAATTGTTGGAGTCTTTGGACAAGGACATACCCTGAAGCAATGCTGTTTTAATGCG
CTTAAACCGAAGGAATAAACAACGCCTACTTAATTAAAATCTAGTTAGAACGTCAGATTGTTTGTCAGATCAATTATTGCGTACCCAAGAGGATAGACAG
TTGCTGTTTCTCGACTTGTTCTGCGTCCGAACTAAGTACCACATCATACCAACTAGAGCGTAATCAAGATATTTACTCTCATTTGATGCCGTAGTGTATA
GTATTCGCACAATTGTTTCTAATTCTTGTTTTGAGCACGGGGGAGCGACTCGTTCGTTACCACTTTCTTCTCGATTTGTGCAGTACCTTCCGAGTCTCGA
TAGAATCTGTTGTAGCTGGGGCTTCGCTAACCCGCTCTGTAGCGGGTATTTATCTACCAACCAGTTTTTTTTTATGTTTCCATAGTATGCAAGACATTTA
TTTGTAGCTAAAATTTTGTCCTGGGACCGTGCTAGTGAATTTGCATACTTGTCTATCATAATACGAAGCACTTTACCTGTCTTATCAGCATCGATAAGCT
TGTGCGCGGCTGAAAGTGTCATTCCTTCGGCATTCTGAAACGTGATGAAGGAGTTCAACGCTGTCGTTCGCGCCTTCTTGCTGTTATTGTGAATTCCGTC
CAAATTTGCCGGTTTGGGTCTGTTCGAGGAGCGGGAGGACAATCGCCCTAATATAAATCCAAGTCATTAGTAGAACCAACCAAGTCTTTTCTTACCACAT
GTCAGGATCTTATTTCGTACTTAAACGGGTCAGTATACGGTATTGTATACGCTGGGCTATTTGGGGGAGGTTCATTCAAAGAACCGCCCATGGAAATTTT
GAGTAGAACTCACAATACCAGGGGCCAAGGATGTTATCGACATGACTGATACTTCGCAATTTTATCTATGTACAGTAACCCCCTACTGTTGGCTACCGTC
AGAAACTTCAGGATATTTTTAGAATATGACTTTATATAGAAGTCAGTATCCGATAGACACTATGTTTCAAAGATTCTAACTAAATATTGTCAGAATGGTT
GGAAACCTGCTCCTATCCAGATGCTTCTTCCGTTGGTGTAAAATAAGCCCTTTGTTAATGAGGATTGGTTGAAATACGGAAAATGGTGTTAGTATGTGAT
TGCATAGTCAGGTAACGGTTGGAATGTAGTGGATATTATACCATAACATAAAATCTCCGACCGTCACAAAACAGGTCCATATTTGTATGTAAGTTATGTA
CTTGTGTAAGTTGCTTCGGGGATCATATTTTGGGATTTGCACAAAAGGCGATGTGTAACGAGTTTGTAGCGGGATTGTTAGGCTCCGAAACTGCCTGTGG
AAAAAAAAATGAAAACGGCAATTAACTGATTATGCATTATTTAAGCCCTGAGGCATATTCTCTCTACATAGCAAATAACAAAATGAGTTTTCCGGACCAG
AAATCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN